EMAIL THIS PAGE TO A FRIEND

ALDH3B2

aldehyde dehydrogenase 3 family, member B2

Synonyms: ALDH8
UniProtKB ID: P48448, Q53Y98, Q8NAL5, Q96IB2
Gene ID:
Human(222) Summary: This gene encodes a member of the aldehyde dehydrogenase family, a group of isozymes that may play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. The gene of this particular family member is over 10 kb in length. The expression of these transcripts is restricted to the salivary gland among the human tissues examined. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(621603) aldehyde dehydrogenase 3 family, member B2
Rat(688800) aldehyde dehydrogenase 3 family, member B2
naked mole-rat(101724442) aldehyde dehydrogenase 3 family, member B2
Zebrafish(100270741) aldehyde dehydrogenase 3 family, member B2
Gene Class: Dehydrogenase
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000695 Rosetta Predictions human pricing
NM_001031615 Rosetta Predictions human pricing
XM_001068348 Rosetta Predictions rat pricing
XM_129134 Rosetta Predictions mouse pricing
XM_974140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063068 predicted 1117
2 SASI_Hs01_00063069 predicted 582
3 SASI_Hs01_00063070 predicted 1517
4 SASI_Hs01_00063072 predicted 516
5 SASI_Hs01_00063073 predicted 1622
6 SASI_Hs01_00063074 predicted 1353
7 SASI_Hs01_00063075 predicted 1806
8 SASI_Hs01_00063076 predicted 456
9 SASI_Hs01_00063071 predicted 1508
10 SASI_Hs01_00063077 predicted 2053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138154 predicted 962
2 SASI_Hs01_00138155 predicted 430
3 SASI_Hs01_00138156 predicted 1368
4 SASI_Hs01_00138158 predicted 364
5 SASI_Hs01_00138159 predicted 1462
6 SASI_Hs01_00138160 predicted 1194
7 SASI_Hs01_00138161 predicted 1642
8 SASI_Hs01_00138162 predicted 297
9 SASI_Hs01_00138157 predicted 1354
10 SASI_Hs01_00138163 predicted 1896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324247 predicted 1073
2 SASI_Rn02_00324248 predicted 1047
3 SASI_Rn02_00324249 predicted 1055
4 SASI_Rn02_00324250 predicted 1125
5 SASI_Rn02_00324251 predicted 1174
6 SASI_Rn02_00324252 predicted 980
7 SASI_Rn02_00324253 predicted 1090
8 SASI_Rn02_00324254 predicted 1078
9 SASI_Rn02_00324255 predicted 1048
10 SASI_Rn02_00324256 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129134 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00264026 predicted 1730
2 SASI_Mm01_00264027 predicted 1734
3 SASI_Mm01_00264028 predicted 1716
4 SASI_Mm01_00264029 predicted 346
5 SASI_Mm01_00264030 predicted 1632
6 SASI_Mm01_00264024 predicted 419
7 SASI_Mm01_00264025 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_974140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445231 predicted 603
2 SASI_Mm02_00445232 predicted 286
3 SASI_Mm02_00445233 predicted 759
4 SASI_Mm02_00445234 predicted 676
5 SASI_Mm02_00445235 predicted 812
6 SASI_Mm02_00445236 predicted 761
7 SASI_Mm02_00445237 predicted 373
8 SASI_Mm02_00445238 predicted 741
9 SASI_Mm02_00445239 predicted 1862
10 SASI_Mm02_00445240 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000695
ALDH3B2 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 3 family, member B2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1336s1c1
Sequence:CCGGCTTCACCTACATATCTCTGCTCTCGAGAGCAGAGATATGTAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1492s1c1
Sequence:CCGGCCCACCCTATACCGACTGGAACTCGAGTTCCAGTCGGTATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1464s1c1
Sequence:CCGGGCCTGGAGAAATTAAAGGAGACTCGAGTCTCCTTTAATTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1273s1c1
Sequence:CCGGCAGACAGGTTGTGAACCAGATCTCGAGATCTGGTTCACAACCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000695
ALDH3B2 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 3 family, member B2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1336s1c1
Sequence:CCGGCTTCACCTACATATCTCTGCTCTCGAGAGCAGAGATATGTAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1492s1c1
Sequence:CCGGCCCACCCTATACCGACTGGAACTCGAGTTCCAGTCGGTATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1464s1c1
Sequence:CCGGGCCTGGAGAAATTAAAGGAGACTCGAGTCTCCTTTAATTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1273s1c1
Sequence:CCGGCAGACAGGTTGTGAACCAGATCTCGAGATCTGGTTCACAACCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000695
ALDH3B2 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 3 family, member B2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1336s1c1
Sequence:CCGGCTTCACCTACATATCTCTGCTCTCGAGAGCAGAGATATGTAGGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1492s1c1
Sequence:CCGGCCCACCCTATACCGACTGGAACTCGAGTTCCAGTCGGTATAGGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1464s1c1
Sequence:CCGGGCCTGGAGAAATTAAAGGAGACTCGAGTCTCCTTTAATTTCTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000695.2-1273s1c1
Sequence:CCGGCAGACAGGTTGTGAACCAGATCTCGAGATCTGGTTCACAACCTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks