EMAIL THIS PAGE TO A FRIEND

ALDH4A1

aldehyde dehydrogenase 4 family, member A1

76 Gene Product Result for
Synonyms: ALDH4 P5CD P5CDh
Gene ID:
Human(8659) Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
Mouse(212647) aldehyde dehydrogenase 4 family, member A1
Rat(641316) aldehyde dehydrogenase 4 family, member A1
Zebrafish(394133) aldehyde dehydrogenase 4 family, member A1
cow(100126042) aldehyde dehydrogenase 4 family, member A1
Horse(100147246) aldehyde dehydrogenase 4 family, member A1
domestic cat(101089025) aldehyde dehydrogenase 4 family, member A1
dog(612452) aldehyde dehydrogenase 4 family, member A1
chicken(419467) aldehyde dehydrogenase 4 family, member A1
naked mole-rat(101697983) aldehyde dehydrogenase 4 family, member A1
domestic guinea pig(100725849) aldehyde dehydrogenase 4 family, member A1
sheep(101105895) aldehyde dehydrogenase 4 family, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048021 MISSION® esiRNA esiRNA targeting mouse Aldh4a1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003748 Rosetta Predictions human pricing
NM_170726 Rosetta Predictions human pricing
NM_001134698 Rosetta Predictions rat pricing
NM_175438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242114 predicted 895
2 SASI_Hs01_00242115 predicted 1309
3 SASI_Hs01_00242116 predicted 661
4 SASI_Hs01_00242117 predicted 739
5 SASI_Hs01_00242118 predicted 993
6 SASI_Hs01_00242119 predicted 388
7 SASI_Hs01_00242120 predicted 949
8 SASI_Hs02_00336213 predicted 888
9 SASI_Hs01_00242121 predicted 1552
10 SASI_Hs01_00242122 predicted 1541
11 SASI_Hs01_00242123 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199404 predicted 891
2 SASI_Hs01_00199405 predicted 1316
3 SASI_Hs01_00199406 predicted 669
4 SASI_Hs01_00199407 predicted 744
5 SASI_Hs01_00199408 predicted 995
6 SASI_Hs01_00199409 predicted 391
7 SASI_Hs01_00199410 predicted 945
8 SASI_Hs02_00367687 predicted 886
9 SASI_Hs01_00199411 predicted 1557
10 SASI_Hs01_00199412 predicted 1546
11 SASI_Hs01_00199413 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257999 predicted 501
2 SASI_Rn02_00258000 predicted 282
3 SASI_Rn02_00258001 predicted 1657
4 SASI_Rn02_00258002 predicted 1740
5 SASI_Rn02_00258003 predicted 1282
6 SASI_Rn02_00258004 predicted 1316
7 SASI_Rn02_00258005 predicted 1387
8 SASI_Rn02_00258006 predicted 866
9 SASI_Rn02_00258007 predicted 334
10 SASI_Rn02_00258008 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110652 predicted 949
2 SASI_Mm01_00110653 predicted 602
3 SASI_Mm01_00110654 predicted 412
4 SASI_Mm01_00110655 predicted 1565
5 SASI_Mm01_00110656 predicted 1752
6 SASI_Mm01_00110657 predicted 1644
7 SASI_Mm01_00110658 predicted 219
8 SASI_Mm01_00110659 predicted 1067
9 SASI_Mm01_00110660 predicted 1729
10 SASI_Mm01_00110661 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170726
VALIDATED
ALDH4A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 4 family, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-1561s1c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-1000s1c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-553s1c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-679s1c1
Sequence:CCGGGCCCTTTAACTTCACTGCAATCTCGAGATTGCAGTGAAGTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-331s1c1
Sequence:CCGGCAAGTTCTGTTATGCAGACAACTCGAGTTGTCTGCATAACAGAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1561s21c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170726.1-1809s21c1
Sequence:CCGGGAGTGGTCAGAGATCTGTAAACTCGAGTTTACAGATCTCTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1000s21c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-399s21c1
Sequence:CCGGAGTGGGACCTGAAGCCTATTGCTCGAGCAATAGGCTTCAGGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-553s21c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170726
VALIDATED
ALDH4A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 4 family, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-1561s1c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-1000s1c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-553s1c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-679s1c1
Sequence:CCGGGCCCTTTAACTTCACTGCAATCTCGAGATTGCAGTGAAGTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-331s1c1
Sequence:CCGGCAAGTTCTGTTATGCAGACAACTCGAGTTGTCTGCATAACAGAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1561s21c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170726.1-1809s21c1
Sequence:CCGGGAGTGGTCAGAGATCTGTAAACTCGAGTTTACAGATCTCTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1000s21c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-399s21c1
Sequence:CCGGAGTGGGACCTGAAGCCTATTGCTCGAGCAATAGGCTTCAGGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-553s21c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170726
VALIDATED
ALDH4A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 4 family, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-1561s1c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-1000s1c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-553s1c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_170726.1-679s1c1
Sequence:CCGGGCCCTTTAACTTCACTGCAATCTCGAGATTGCAGTGAAGTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170726.1-331s1c1
Sequence:CCGGCAAGTTCTGTTATGCAGACAACTCGAGTTGTCTGCATAACAGAACTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1561s21c1
Sequence:CCGGCAACTTCTACATCAACGACAACTCGAGTTGTCGTTGATGTAGAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170726.1-1809s21c1
Sequence:CCGGGAGTGGTCAGAGATCTGTAAACTCGAGTTTACAGATCTCTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-1000s21c1
Sequence:CCGGCGGCGGAAAGAACTTCCACTTCTCGAGAAGTGGAAGTTCTTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-399s21c1
Sequence:CCGGAGTGGGACCTGAAGCCTATTGCTCGAGCAATAGGCTTCAGGTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170726.1-553s21c1
Sequence:CCGGCATCGACTTCTTCCGGTTCAACTCGAGTTGAACCGGAAGAAGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175438
VALIDATED
ALDH4A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 4 family, member A1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-1631s1c1
Sequence:CCGGGCAACTTCTACATCAACGATACTCGAGTATCGTTGATGTAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-957s1c1
Sequence:CCGGGCACCTTTGTGGCATCAATTTCTCGAGAAATTGATGCCACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-375s1c1
Sequence:CCGGGCCCTTTAACCATGCACACAACTCGAGTTGTGTGCATGGTTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-1473s1c1
Sequence:CCGGCGGTCCTGTGTTGACAGTATACTCGAGTATACTGTCAACACAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-3042s1c1
Sequence:CCGGCGGAGGATCAATGGGCTAATTCTCGAGAATTAGCCCATTGATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1424s21c1
Sequence:CCGGCAAGGCCTTTGCTCGCATTAACTCGAGTTAATGCGAGCAAAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-457s21c1
Sequence:CCGGAGGTGTGGACCTCCGATATACCTCGAGGTATATCGGAGGTCCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-1953s21c1
Sequence:CCGGGTTGTCAAGCAGATGTCCATCCTCGAGGATGGACATCTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2329s21c1
Sequence:CCGGTACACATGTCCAGTGAGATAGCTCGAGCTATCTCACTGGACATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1611s21c1
Sequence:CCGGGTGTACCCAGATGATAAATACCTCGAGGTATTTATCATCTGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2231s21c1
Sequence:CCGGAGAACCTAAAGGGATATTCTCCTCGAGGAGAATATCCCTTTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175438
VALIDATED
ALDH4A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 4 family, member A1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-1631s1c1
Sequence:CCGGGCAACTTCTACATCAACGATACTCGAGTATCGTTGATGTAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-957s1c1
Sequence:CCGGGCACCTTTGTGGCATCAATTTCTCGAGAAATTGATGCCACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-375s1c1
Sequence:CCGGGCCCTTTAACCATGCACACAACTCGAGTTGTGTGCATGGTTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-1473s1c1
Sequence:CCGGCGGTCCTGTGTTGACAGTATACTCGAGTATACTGTCAACACAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-3042s1c1
Sequence:CCGGCGGAGGATCAATGGGCTAATTCTCGAGAATTAGCCCATTGATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1424s21c1
Sequence:CCGGCAAGGCCTTTGCTCGCATTAACTCGAGTTAATGCGAGCAAAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-457s21c1
Sequence:CCGGAGGTGTGGACCTCCGATATACCTCGAGGTATATCGGAGGTCCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-1953s21c1
Sequence:CCGGGTTGTCAAGCAGATGTCCATCCTCGAGGATGGACATCTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2329s21c1
Sequence:CCGGTACACATGTCCAGTGAGATAGCTCGAGCTATCTCACTGGACATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1611s21c1
Sequence:CCGGGTGTACCCAGATGATAAATACCTCGAGGTATTTATCATCTGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2231s21c1
Sequence:CCGGAGAACCTAAAGGGATATTCTCCTCGAGGAGAATATCCCTTTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175438
VALIDATED
ALDH4A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 4 family, member A1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-1631s1c1
Sequence:CCGGGCAACTTCTACATCAACGATACTCGAGTATCGTTGATGTAGAAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-957s1c1
Sequence:CCGGGCACCTTTGTGGCATCAATTTCTCGAGAAATTGATGCCACAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-375s1c1
Sequence:CCGGGCCCTTTAACCATGCACACAACTCGAGTTGTGTGCATGGTTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175438.3-1473s1c1
Sequence:CCGGCGGTCCTGTGTTGACAGTATACTCGAGTATACTGTCAACACAGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041423    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175438.3-3042s1c1
Sequence:CCGGCGGAGGATCAATGGGCTAATTCTCGAGAATTAGCCCATTGATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1424s21c1
Sequence:CCGGCAAGGCCTTTGCTCGCATTAACTCGAGTTAATGCGAGCAAAGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-457s21c1
Sequence:CCGGAGGTGTGGACCTCCGATATACCTCGAGGTATATCGGAGGTCCACACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-1953s21c1
Sequence:CCGGGTTGTCAAGCAGATGTCCATCCTCGAGGATGGACATCTGCTTGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2329s21c1
Sequence:CCGGTACACATGTCCAGTGAGATAGCTCGAGCTATCTCACTGGACATGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175438.4-1611s21c1
Sequence:CCGGGTGTACCCAGATGATAAATACCTCGAGGTATTTATCATCTGGGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175438.4-2231s21c1
Sequence:CCGGAGAACCTAAAGGGATATTCTCCTCGAGGAGAATATCCCTTTAGGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks