EMAIL THIS PAGE TO A FRIEND

ALDH5A1

aldehyde dehydrogenase 5 family, member A1

97 Gene Product Result for
Synonyms: SSADH SSDH
UniProtKB ID: P51649, B2RD26, G5E949, Q8N3W6
Gene ID:
Human(7915) Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. This gene encodes a mitochondrial NAD(+)-dependent succinic semialdehyde dehydrogenase. A deficiency of this enzyme, known as 4-hydroxybutyricaciduria, is a rare inborn error in the metabolism of the neurotransmitter 4-aminobutyric acid (GABA). In response to the defect, physiologic fluids from patients accumulate GHB, a compound with numerous neuromodulatory properties. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(214579) aldhehyde dehydrogenase family 5, subfamily A1
Rat(291133) aldehyde dehydrogenase 5 family, member A1
naked mole-rat(101723101) aldehyde dehydrogenase 5 family, member A1
domestic guinea pig(100735182) aldehyde dehydrogenase 5 family, member A1
sheep(101107828) aldehyde dehydrogenase 5 family, member A1
Domestic Rabbit(100351836) aldehyde dehydrogenase 5 family, member A1
Zebrafish(565235) aldehyde dehydrogenase 5 family, member A1 (succinate-semialdehyde dehydrogenase)
cow(532724) aldehyde dehydrogenase 5 family, member A1
domestic cat(101088238) aldehyde dehydrogenase 5 family, member A1
dog(488246) aldehyde dehydrogenase 5 family, member A1
chicken(420818) aldehyde dehydrogenase 5 family, member A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080 Rosetta Predictions human pricing
NM_170740 Rosetta Predictions human pricing
XM_001062804 Rosetta Predictions rat pricing
XM_001062860 Rosetta Predictions rat pricing
XM_001062926 Rosetta Predictions rat pricing
XM_214478 Rosetta Predictions rat pricing
NM_172532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314150 predicted 1626
2 SASI_Hs01_00127747 predicted 1152
3 SASI_Hs01_00127748 predicted 1620
4 SASI_Hs01_00127749 predicted 1352
5 SASI_Hs01_00127750 predicted 1011
6 SASI_Hs01_00127751 predicted 489
7 SASI_Hs01_00127752 predicted 1583
8 SASI_Hs01_00127753 predicted 1594
9 SASI_Hs01_00127755 predicted 1489
10 SASI_Hs01_00127756 predicted 1687
11 SASI_Hs01_00127754 predicted 1043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367706 predicted 1665
2 SASI_Hs01_00021734 predicted 1193
3 SASI_Hs01_00021735 predicted 1666
4 SASI_Hs01_00021736 predicted 1396
5 SASI_Hs01_00021737 predicted 1045
6 SASI_Hs01_00021738 predicted 484
7 SASI_Hs01_00021739 predicted 1624
8 SASI_Hs01_00021740 predicted 1635
9 SASI_Hs01_00021742 predicted 1523
10 SASI_Hs01_00021743 predicted 1726
11 SASI_Hs01_00021741 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304667 predicted 969
2 SASI_Rn02_00304668 predicted 952
3 SASI_Rn02_00304669 predicted 852
4 SASI_Rn02_00304670 predicted 1215
5 SASI_Rn02_00304671 predicted 577
6 SASI_Rn02_00304672 predicted 1337
7 SASI_Rn02_00304673 predicted 1270
8 SASI_Rn02_00304674 predicted 1115
9 SASI_Rn02_00304675 predicted 575
10 SASI_Rn02_00304676 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304847 predicted 934
2 SASI_Rn02_00304848 predicted 915
3 SASI_Rn02_00304849 predicted 809
4 SASI_Rn02_00304850 predicted 1179
5 SASI_Rn02_00304851 predicted 582
6 SASI_Rn02_00304852 predicted 1297
7 SASI_Rn02_00304853 predicted 1235
8 SASI_Rn02_00304854 predicted 1075
9 SASI_Rn02_00304855 predicted 579
10 SASI_Rn02_00304856 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305119 predicted 941
2 SASI_Rn02_00305120 predicted 919
3 SASI_Rn02_00305121 predicted 815
4 SASI_Rn02_00305122 predicted 1629
5 SASI_Rn02_00305123 predicted 1184
6 SASI_Rn02_00305124 predicted 589
7 SASI_Rn02_00305125 predicted 1600
8 SASI_Rn02_00305126 predicted 1301
9 SASI_Rn02_00305127 predicted 1076
10 SASI_Rn02_00305128 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375325 predicted 423
2 SASI_Rn02_00375326 predicted 462
3 SASI_Rn02_00375327 predicted 427
4 SASI_Rn02_00375328 predicted 400
5 SASI_Rn02_00375329 predicted 424
6 SASI_Rn02_00375330 predicted 409
7 SASI_Rn02_00375331 predicted 460
8 SASI_Rn02_00375332 predicted 203
9 SASI_Rn02_00375333 predicted 275
10 SASI_Rn02_00375334 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137024 predicted 420
2 SASI_Mm01_00137025 predicted 1624
3 SASI_Mm01_00137026 predicted 946
4 SASI_Mm01_00137027 predicted 585
5 SASI_Mm01_00137028 predicted 1241
6 SASI_Mm01_00137029 predicted 1116
7 SASI_Mm01_00137030 predicted 1366
8 SASI_Mm02_00344141 predicted 430
9 SASI_Mm01_00137032 predicted 928
10 SASI_Mm01_00137033 predicted 948
11 SASI_Mm01_00137031 predicted 1389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170740
VALIDATED
ALDH5A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 5 family, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-398s21c1
Sequence:CCGGCTTCGGAAGTGGTACAATTTACTCGAGTAAATTGTACCACTTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1456s21c1
Sequence:CCGGTGTTGGGTTAGCAGGTTATTTCTCGAGAAATAACCTGCTAACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1537s21c1
Sequence:CCGGTGGCGTCAACGAAGGATTAATCTCGAGATTAATCCTTCGTTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1197s21c1
Sequence:CCGGGAACTACTCAGGGCCCATTAACTCGAGTTAATGGGCCCTGAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170740.1-1726s21c1
Sequence:CCGGAGGTACATGCCATCCATTATTCTCGAGAATAATGGATGGCATGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1539s1c1
Sequence:CCGGGCGTCAACGAAGGATTAATTTCTCGAGAAATTAATCCTTCGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1397s1c1
Sequence:CCGGGCACCAGTTATCAAGTTCGATCTCGAGATCGAACTTGATAACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170740.1-1119s1c1
Sequence:CCGGGCATCCATGATGCCTTTGTAACTCGAGTTACAAAGGCATCATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-443s1c1
Sequence:CCGGGCCAGAATAATCACAGCTGAACTCGAGTTCAGCTGTGATTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-543s1c1
Sequence:CCGGGCCGTGTTTACGGAGACATTACTCGAGTAATGTCTCCGTAAACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170740
VALIDATED
ALDH5A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 5 family, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-398s21c1
Sequence:CCGGCTTCGGAAGTGGTACAATTTACTCGAGTAAATTGTACCACTTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1456s21c1
Sequence:CCGGTGTTGGGTTAGCAGGTTATTTCTCGAGAAATAACCTGCTAACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1537s21c1
Sequence:CCGGTGGCGTCAACGAAGGATTAATCTCGAGATTAATCCTTCGTTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1197s21c1
Sequence:CCGGGAACTACTCAGGGCCCATTAACTCGAGTTAATGGGCCCTGAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170740.1-1726s21c1
Sequence:CCGGAGGTACATGCCATCCATTATTCTCGAGAATAATGGATGGCATGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1539s1c1
Sequence:CCGGGCGTCAACGAAGGATTAATTTCTCGAGAAATTAATCCTTCGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1397s1c1
Sequence:CCGGGCACCAGTTATCAAGTTCGATCTCGAGATCGAACTTGATAACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170740.1-1119s1c1
Sequence:CCGGGCATCCATGATGCCTTTGTAACTCGAGTTACAAAGGCATCATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-443s1c1
Sequence:CCGGGCCAGAATAATCACAGCTGAACTCGAGTTCAGCTGTGATTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-543s1c1
Sequence:CCGGGCCGTGTTTACGGAGACATTACTCGAGTAATGTCTCCGTAAACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170740
VALIDATED
ALDH5A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 5 family, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-398s21c1
Sequence:CCGGCTTCGGAAGTGGTACAATTTACTCGAGTAAATTGTACCACTTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1456s21c1
Sequence:CCGGTGTTGGGTTAGCAGGTTATTTCTCGAGAAATAACCTGCTAACCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1537s21c1
Sequence:CCGGTGGCGTCAACGAAGGATTAATCTCGAGATTAATCCTTCGTTGACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170740.1-1197s21c1
Sequence:CCGGGAACTACTCAGGGCCCATTAACTCGAGTTAATGGGCCCTGAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170740.1-1726s21c1
Sequence:CCGGAGGTACATGCCATCCATTATTCTCGAGAATAATGGATGGCATGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1539s1c1
Sequence:CCGGGCGTCAACGAAGGATTAATTTCTCGAGAAATTAATCCTTCGTTGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-1397s1c1
Sequence:CCGGGCACCAGTTATCAAGTTCGATCTCGAGATCGAACTTGATAACTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170740.1-1119s1c1
Sequence:CCGGGCATCCATGATGCCTTTGTAACTCGAGTTACAAAGGCATCATGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-443s1c1
Sequence:CCGGGCCAGAATAATCACAGCTGAACTCGAGTTCAGCTGTGATTATTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_170740.1-543s1c1
Sequence:CCGGGCCGTGTTTACGGAGACATTACTCGAGTAATGTCTCCGTAAACACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172532
ALDH5A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 5 family, member A1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-809s1c1
Sequence:CCGGGCAGGTGTCTACAACGTCATTCTCGAGAATGACGTTGTAGACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-428s1c1
Sequence:CCGGCTCCGTAAATGGTACGACTTACTCGAGTAAGTCGTACCATTTACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172532.1-1782s1c1
Sequence:CCGGGCCTCATTTCTTAGATGTAAACTCGAGTTTACATCTAAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-932s1c1
Sequence:CCGGCTGCTACATCACGCAGCAAATCTCGAGATTTGCTGCGTGATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172532
ALDH5A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 5 family, member A1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-809s1c1
Sequence:CCGGGCAGGTGTCTACAACGTCATTCTCGAGAATGACGTTGTAGACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-428s1c1
Sequence:CCGGCTCCGTAAATGGTACGACTTACTCGAGTAAGTCGTACCATTTACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172532.1-1782s1c1
Sequence:CCGGGCCTCATTTCTTAGATGTAAACTCGAGTTTACATCTAAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-932s1c1
Sequence:CCGGCTGCTACATCACGCAGCAAATCTCGAGATTTGCTGCGTGATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172532
ALDH5A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 5 family, member A1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-809s1c1
Sequence:CCGGGCAGGTGTCTACAACGTCATTCTCGAGAATGACGTTGTAGACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-428s1c1
Sequence:CCGGCTCCGTAAATGGTACGACTTACTCGAGTAAGTCGTACCATTTACGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172532.1-1782s1c1
Sequence:CCGGGCCTCATTTCTTAGATGTAAACTCGAGTTTACATCTAAGAAATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172532.1-932s1c1
Sequence:CCGGCTGCTACATCACGCAGCAAATCTCGAGATTTGCTGCGTGATGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks