EMAIL THIS PAGE TO A FRIEND

ALDH6A1

aldehyde dehydrogenase 6 family, member A1

86 Gene Product Result for
Synonyms: MMSADHA MMSDH
UniProtKB ID: Q02252, B2R609, Q9UKM8
Gene ID:
Human(4329) Summary: This gene encodes a member of the aldehyde dehydrogenase protein family. The encoded protein is a mitochondrial methylmalonate semialdehyde dehydrogenase that plays a role in the valine and pyrimidine catabolic pathways. This protein catalyzes the irreversible oxidative decarboxylation of malonate and methylmalonate semialdehydes to acetyl- and propionyl-CoA. Methylmalonate semialdehyde dehydrogenase deficiency is characterized by elevated beta-alanine, 3-hydroxypropionic acid, and both isomers of 3-amino and 3-hydroxyisobutyric acids in urine organic acids. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(104776) aldehyde dehydrogenase family 6, subfamily A1
Rat(81708) aldehyde dehydrogenase 6 family, member A1
Zebrafish(436647) aldehyde dehydrogenase 6 family, member A1
chicken(423345) aldehyde dehydrogenase 6 family, member A1
cow(327692) aldehyde dehydrogenase 6 family, member A1
domestic cat(101090776) aldehyde dehydrogenase 6 family, member A1
dog(490779) aldehyde dehydrogenase 6 family, member A1
sheep(101106176) aldehyde dehydrogenase 6 family, member A1
domestic guinea pig(100732213) aldehyde dehydrogenase 6 family, member A1
naked mole-rat(101705709) aldehyde dehydrogenase 6 family, member A1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A9733 Anti-ALDH6A1 (506-520) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A9608 Anti-ALDH6A1 (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1300193 Anti-ALDH6A1 (C-term) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1300192 Anti-ALDH6A1 (N-term) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2501339 Anti-ALDH6A1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, bovine, human, canine
ELISA, immunohistochemistry, western blot pricing
SAB2501340 Anti-ALDH6A1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1400167 Anti-ALDH6A1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing
HPA029072 Anti-ALDH6A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 human, rat, mouse
immunohistochemistry, western blot pricing
HPA029073 Anti-ALDH6A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA029074 Anti-ALDH6A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab3 human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA029075 Anti-ALDH6A1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab4 human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103594 Anti-ALDH6A1 antibody produced in rabbit affinity isolated antibody , horse, bovine, rabbit, human, zebrafish, mouse, rat, guinea pig
western blot pricing
SAB2103665 Anti-ALDH6A1 antibody produced in rabbit affinity isolated antibody , rat, zebrafish, rabbit, human, guinea pig, bovine, mouse, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005589 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005589 Rosetta Predictions human pricing
NM_031057 Rosetta Predictions rat pricing
NM_134042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221402 predicted 856
2 SASI_Hs02_00339884 predicted 1697
3 SASI_Hs01_00221404 predicted 849
4 SASI_Hs01_00221405 predicted 253
5 SASI_Hs01_00221406 predicted 1792
6 SASI_Hs01_00221407 predicted 1627
7 SASI_Hs01_00221408 predicted 738
8 SASI_Hs01_00221409 predicted 457
9 SASI_Hs01_00221410 predicted 1599
10 SASI_Hs01_00221411 predicted 1586
11 SASI_Hs01_00221403 predicted 1734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098538 predicted 1587
2 SASI_Rn01_00098541 predicted 881
3 SASI_Rn01_00098540 predicted 1722
4 SASI_Rn01_00098542 predicted 1745
5 SASI_Rn01_00098543 predicted 402
6 SASI_Rn02_00264292 predicted 383
7 SASI_Rn01_00098544 predicted 1029
8 SASI_Rn01_00098545 predicted 200
9 SASI_Rn01_00098546 predicted 1241
10 SASI_Rn02_00264293 predicted 1532
11 SASI_Rn01_00098539 predicted 1186
12 SASI_Rn01_00098547 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149157 predicted 1212
2 SASI_Mm01_00149158 predicted 1211
3 SASI_Mm01_00149159 predicted 1113
4 SASI_Mm01_00149160 predicted 727
5 SASI_Mm01_00149161 predicted 370
6 SASI_Mm01_00149163 predicted 1621
7 SASI_Mm01_00149164 predicted 1499
8 SASI_Mm01_00149165 predicted 843
9 SASI_Mm02_00339211 predicted 729
10 SASI_Mm01_00149166 predicted 809
11 SASI_Mm01_00149162 predicted 1038
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005589
VALIDATED
ALDH6A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 6 family, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1608s1c1
Sequence:CCGGCCAATTCTACACTCAGTTAAACTCGAGTTTAACTGAGTGTAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1195s1c1
Sequence:CCGGCGAGTCTGTAATCTGATTGATCTCGAGATCAATCAGATTACAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-457s1c1
Sequence:CCGGGCCAAGTTAATCACATTGGAACTCGAGTTCCAATGTGATTAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-222s1c1
Sequence:CCGGGCTCTTCATTGGTGGGAAATTCTCGAGAATTTCCCACCAATGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-637s1c1
Sequence:CCGGGCAGGCATTGCTCCATTCAATCTCGAGATTGAATGGAGCAATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-256s21c1
Sequence:CCGGAGTGACAAATGGATCGATATCCTCGAGGATATCGATCCATTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1862s21c1
Sequence:CCGGTAGGGAACTGCCTAGTGTAACCTCGAGGTTACACTAGGCAGTTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-417s21c1
Sequence:CCGGCCGCTATCAACAACTTATTAACTCGAGTTAATAAGTTGTTGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1197s21c1
Sequence:CCGGAGTCTGTAATCTGATTGATAGCTCGAGCTATCAATCAGATTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005589.2-1311s21c1
Sequence:CCGGCTCGAATGTCAAGCCAAATATCTCGAGATATTTGGCTTGACATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005589
VALIDATED
ALDH6A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 6 family, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1608s1c1
Sequence:CCGGCCAATTCTACACTCAGTTAAACTCGAGTTTAACTGAGTGTAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1195s1c1
Sequence:CCGGCGAGTCTGTAATCTGATTGATCTCGAGATCAATCAGATTACAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-457s1c1
Sequence:CCGGGCCAAGTTAATCACATTGGAACTCGAGTTCCAATGTGATTAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-222s1c1
Sequence:CCGGGCTCTTCATTGGTGGGAAATTCTCGAGAATTTCCCACCAATGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-637s1c1
Sequence:CCGGGCAGGCATTGCTCCATTCAATCTCGAGATTGAATGGAGCAATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-256s21c1
Sequence:CCGGAGTGACAAATGGATCGATATCCTCGAGGATATCGATCCATTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1862s21c1
Sequence:CCGGTAGGGAACTGCCTAGTGTAACCTCGAGGTTACACTAGGCAGTTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-417s21c1
Sequence:CCGGCCGCTATCAACAACTTATTAACTCGAGTTAATAAGTTGTTGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1197s21c1
Sequence:CCGGAGTCTGTAATCTGATTGATAGCTCGAGCTATCAATCAGATTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005589.2-1311s21c1
Sequence:CCGGCTCGAATGTCAAGCCAAATATCTCGAGATATTTGGCTTGACATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005589
VALIDATED
ALDH6A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 6 family, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1608s1c1
Sequence:CCGGCCAATTCTACACTCAGTTAAACTCGAGTTTAACTGAGTGTAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-1195s1c1
Sequence:CCGGCGAGTCTGTAATCTGATTGATCTCGAGATCAATCAGATTACAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-457s1c1
Sequence:CCGGGCCAAGTTAATCACATTGGAACTCGAGTTCCAATGTGATTAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-222s1c1
Sequence:CCGGGCTCTTCATTGGTGGGAAATTCTCGAGAATTTCCCACCAATGAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_005589.2-637s1c1
Sequence:CCGGGCAGGCATTGCTCCATTCAATCTCGAGATTGAATGGAGCAATGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-256s21c1
Sequence:CCGGAGTGACAAATGGATCGATATCCTCGAGGATATCGATCCATTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343819    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1862s21c1
Sequence:CCGGTAGGGAACTGCCTAGTGTAACCTCGAGGTTACACTAGGCAGTTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-417s21c1
Sequence:CCGGCCGCTATCAACAACTTATTAACTCGAGTTAATAAGTTGTTGATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005589.2-1197s21c1
Sequence:CCGGAGTCTGTAATCTGATTGATAGCTCGAGCTATCAATCAGATTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005589.2-1311s21c1
Sequence:CCGGCTCGAATGTCAAGCCAAATATCTCGAGATATTTGGCTTGACATTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134042
VALIDATED
ALDH6A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 6 family, member A1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-59s1c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-1212s1c1
Sequence:CCGGCCAACCATCATCTCAAATGTTCTCGAGAACATTTGAGATGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-491s1c1
Sequence:CCGGGCCATCTATCACCAAAGACATCTCGAGATGTCTTTGGTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134042.1-1491s1c1
Sequence:CCGGGACACCAATTTCTATGGCAAACTCGAGTTTGCCATAGAAATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-549s1c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-704s21c1
Sequence:CCGGTGACGGAACACTGAACATTATCTCGAGATAATGTTCAGTGTTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-328s21c1
Sequence:CCGGTTCGTTATCAGCAGCTCATTACTCGAGTAATGAGCTGCTGATAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-885s21c1
Sequence:CCGGGTCATGCCAGACGCCAATAAGCTCGAGCTTATTGGCGTCTGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-59s21c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2067s21c1
Sequence:CCGGCCACTTTCTTCTGCGTGATTCCTCGAGGAATCACGCAGAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2093s21c1
Sequence:CCGGCACTGTTTAATTCTATCATTGCTCGAGCAATGATAGAATTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-549s21c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134042
VALIDATED
ALDH6A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 6 family, member A1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-59s1c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-1212s1c1
Sequence:CCGGCCAACCATCATCTCAAATGTTCTCGAGAACATTTGAGATGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-491s1c1
Sequence:CCGGGCCATCTATCACCAAAGACATCTCGAGATGTCTTTGGTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134042.1-1491s1c1
Sequence:CCGGGACACCAATTTCTATGGCAAACTCGAGTTTGCCATAGAAATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-549s1c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-704s21c1
Sequence:CCGGTGACGGAACACTGAACATTATCTCGAGATAATGTTCAGTGTTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-328s21c1
Sequence:CCGGTTCGTTATCAGCAGCTCATTACTCGAGTAATGAGCTGCTGATAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-885s21c1
Sequence:CCGGGTCATGCCAGACGCCAATAAGCTCGAGCTTATTGGCGTCTGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-59s21c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2067s21c1
Sequence:CCGGCCACTTTCTTCTGCGTGATTCCTCGAGGAATCACGCAGAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2093s21c1
Sequence:CCGGCACTGTTTAATTCTATCATTGCTCGAGCAATGATAGAATTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-549s21c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134042
VALIDATED
ALDH6A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 6 family, member A1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-59s1c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-1212s1c1
Sequence:CCGGCCAACCATCATCTCAAATGTTCTCGAGAACATTTGAGATGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-491s1c1
Sequence:CCGGGCCATCTATCACCAAAGACATCTCGAGATGTCTTTGGTGATAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134042.1-1491s1c1
Sequence:CCGGGACACCAATTTCTATGGCAAACTCGAGTTTGCCATAGAAATTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134042.1-549s1c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-704s21c1
Sequence:CCGGTGACGGAACACTGAACATTATCTCGAGATAATGTTCAGTGTTCCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-328s21c1
Sequence:CCGGTTCGTTATCAGCAGCTCATTACTCGAGTAATGAGCTGCTGATAACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-885s21c1
Sequence:CCGGGTCATGCCAGACGCCAATAAGCTCGAGCTTATTGGCGTCTGGCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-59s21c1
Sequence:CCGGGCAGGTTTCTTCTAAGGTAAACTCGAGTTTACCTTAGAAGAAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2067s21c1
Sequence:CCGGCCACTTTCTTCTGCGTGATTCCTCGAGGAATCACGCAGAAGAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375154    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134042.2-2093s21c1
Sequence:CCGGCACTGTTTAATTCTATCATTGCTCGAGCAATGATAGAATTAAACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134042.2-549s21c1
Sequence:CCGGGCAGGCATTGCACCATTTAATCTCGAGATTAAATGGTGCAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks