EMAIL THIS PAGE TO A FRIEND

ALDH7A1

aldehyde dehydrogenase 7 family, member A1

71 Gene Product Result for
Synonyms: ATQ1 EPD PDE
Gene ID:
Human(501) Summary: The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
Mouse(110695) aldehyde dehydrogenase family 7, member A1
Rat(291450) aldehyde dehydrogenase 7 family, member A1
Zebrafish(334197) aldehyde dehydrogenase 7 family, member A1
chicken(426812) aldehyde dehydrogenase 7 family, member A1
Horse(100063766) aldehyde dehydrogenase 7 family, member A1
cow(507477) aldehyde dehydrogenase 7 family, member A1
domestic cat(101086623) aldehyde dehydrogenase 7 family, member A1
dog(481486) aldehyde dehydrogenase 7 family, member A1
naked mole-rat(101711696) aldehyde dehydrogenase 7 family, member A1
domestic guinea pig(100732238) aldehyde dehydrogenase 7 family, member A1
sheep(101108127) aldehyde dehydrogenase 7 family, member A1
Domestic Rabbit(100344302) aldehyde dehydrogenase 7 family, member A1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138600 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138600 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138600 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001182 Rosetta Predictions human pricing
XM_001059375 Rosetta Predictions rat pricing
XM_214535 Rosetta Predictions rat pricing
NM_001127338 Rosetta Predictions mouse pricing
NM_138600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052718 predicted 685
2 SASI_Hs01_00052719 predicted 1746
3 SASI_Hs01_00052720 predicted 1725
4 SASI_Hs01_00052721 predicted 565
5 SASI_Hs01_00052722 predicted 441
6 SASI_Hs01_00052724 predicted 531
7 SASI_Hs01_00052725 predicted 1121
8 SASI_Hs01_00052726 predicted 630
9 SASI_Hs01_00052727 predicted 748
10 SASI_Hs02_00331311 predicted 1569
11 SASI_Hs01_00052723 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293006 predicted 343
2 SASI_Rn02_00293007 predicted 1374
3 SASI_Rn02_00293008 predicted 262
4 SASI_Rn02_00293009 predicted 1491
5 SASI_Rn02_00293010 predicted 516
6 SASI_Rn02_00293011 predicted 735
7 SASI_Rn02_00293012 predicted 1607
8 SASI_Rn02_00293013 predicted 561
9 SASI_Rn02_00293014 predicted 242
10 SASI_Rn02_00293015 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375395 predicted 343
2 SASI_Rn02_00375396 predicted 1370
3 SASI_Rn02_00375397 predicted 256
4 SASI_Rn02_00375398 predicted 1491
5 SASI_Rn02_00375399 predicted 515
6 SASI_Rn02_00375400 predicted 732
7 SASI_Rn02_00375401 predicted 1613
8 SASI_Rn02_00375402 predicted 568
9 SASI_Rn02_00375403 predicted 241
10 SASI_Rn02_00375404 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310247 predicted 1863
2 SASI_Mm02_00310248 predicted 1594
3 SASI_Mm02_00310249 predicted 726
4 SASI_Mm02_00310250 predicted 938
5 SASI_Mm02_00310251 predicted 1203
6 SASI_Mm02_00310252 predicted 1394
7 SASI_Mm02_00310253 predicted 911
8 SASI_Mm02_00310254 predicted 1368
9 SASI_Mm02_00310255 predicted 1023
10 SASI_Mm02_00310256 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061905 predicted 1672
2 SASI_Mm01_00061907 predicted 1404
3 SASI_Mm01_00061908 predicted 527
4 SASI_Mm01_00061909 predicted 740
5 SASI_Mm02_00339669 predicted 1004
6 SASI_Mm01_00061911 predicted 1202
7 SASI_Mm01_00061912 predicted 719
8 SASI_Mm01_00061913 predicted 1173
9 SASI_Mm01_00061914 predicted 836
10 SASI_Mm02_00339670 predicted 950
11 SASI_Mm01_00061906 predicted 407
12 SASI_Mm01_00061910 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001182
VALIDATED
ALDH7A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 7 family, member A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1480s21c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-721s21c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1189s21c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-556s21c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1258s1c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1569s1c1
Sequence:CCGGCCAAGGAATCAAGTTTCAGTACTCGAGTACTGAAACTTGATTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-334s1c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-967s1c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-499s1c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001182
VALIDATED
ALDH7A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 7 family, member A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1480s21c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-721s21c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1189s21c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-556s21c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1258s1c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1569s1c1
Sequence:CCGGCCAAGGAATCAAGTTTCAGTACTCGAGTACTGAAACTTGATTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-334s1c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-967s1c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-499s1c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001182
VALIDATED
ALDH7A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 7 family, member A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1480s21c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-721s21c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-1189s21c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001182.3-556s21c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1258s1c1
Sequence:CCGGGCTCCGATTCTCTATGTCTTTCTCGAGAAAGACATAGAGAATCGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-1569s1c1
Sequence:CCGGCCAAGGAATCAAGTTTCAGTACTCGAGTACTGAAACTTGATTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-334s1c1
Sequence:CCGGCGGGAGAAGATCCAAGTACTACTCGAGTAGTACTTGGATCTTCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-967s1c1
Sequence:CCGGGCGAGGCGACTGTTTATACATCTCGAGATGTATAAACAGTCGCCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001182.1-499s1c1
Sequence:CCGGGCACTGATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATCAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138600
VALIDATED
ALDH7A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 7 family, member A1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-603s21c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-962s21c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-808s21c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-404s21c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-1364s21c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-731s1c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1492s1c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138600.1-532s1c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1090s1c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-936s1c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138600
VALIDATED
ALDH7A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 7 family, member A1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-603s21c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-962s21c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-808s21c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-404s21c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-1364s21c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-731s1c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1492s1c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138600.1-532s1c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1090s1c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-936s1c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138600
VALIDATED
ALDH7A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 7 family, member A1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-603s21c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-962s21c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-808s21c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-404s21c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138600.4-1364s21c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-731s1c1
Sequence:CCGGGCTCTCATCGAAATGTGGAATCTCGAGATTCCACATTTCGATGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1492s1c1
Sequence:CCGGCCCAATCCTCTATGTCTTCAACTCGAGTTGAAGACATAGAGGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138600.1-532s1c1
Sequence:CCGGCGGAGAAATAGTCAGAAAGATCTCGAGATCTTTCTGACTATTTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-1090s1c1
Sequence:CCGGGCTTGGAGGAAACAATGCCATCTCGAGATGGCATTGTTTCCTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138600.1-936s1c1
Sequence:CCGGGTGCCATTTGTTCCCTGGTTTCTCGAGAAACCAGGGAACAAATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)