EMAIL THIS PAGE TO A FRIEND

ALDH8A1

aldehyde dehydrogenase 8 family, member A1

Synonyms: ALDH12 DJ352A20.2
UniProtKB ID: Q9H2A2, B7Z521, O60793, Q24JS9, Q53GT3, Q5TI80
Gene ID:
Human(64577) Summary: This protein belongs to the aldehyde dehydrogenases family of proteins. It plays a role in a pathway of 9-cis-retinoic acid biosynthesis in vivo. This enzyme converts 9-cis-retinal into the retinoid X receptor ligand 9-cis-retinoic acid, and has approximately 40-fold higher activity with 9-cis-retinal than with all-trans-retinal. Therefore, it is the first known aldehyde dehydrogenase to show a preference for 9-cis-retinal relative to all-trans-retinal. Three transcript variants encoding distinct protein isoforms have been identified for this gene. [provided by RefSeq, Jul 2010]
Mouse(237320) aldehyde dehydrogenase 8 family, member A1
Rat(685750) aldehyde dehydrogenase 8 family, member A1
Zebrafish(447801) aldehyde dehydrogenase 8 family, member A1
cow(513537) aldehyde dehydrogenase 8 family, member A1
Horse(100067765) aldehyde dehydrogenase 8 family, member A1
domestic cat(101099554) aldehyde dehydrogenase 8 family, member A1
dog(476210) aldehyde dehydrogenase 8 family, member A1
chicken(421695) aldehyde dehydrogenase 8 family, member A1
sheep(101108757) aldehyde dehydrogenase 8 family, member A1
Domestic Rabbit(100347245) aldehyde dehydrogenase 8 family, member A1
domestic guinea pig(100720338) aldehyde dehydrogenase 8 family, member A1
naked mole-rat(101721258) aldehyde dehydrogenase 8 family, member A1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068211 MISSION® esiRNA esiRNA human ALDH8A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022568 Rosetta Predictions human pricing
NM_170771 Rosetta Predictions human pricing
XM_001065122 Rosetta Predictions rat pricing
NM_178713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154954 predicted 1496
2 SASI_Hs01_00154955 predicted 1280
3 SASI_Hs01_00154956 predicted 1453
4 SASI_Hs01_00154957 predicted 320
5 SASI_Hs01_00154958 predicted 1600
6 SASI_Hs01_00154959 predicted 320
7 SASI_Hs01_00154960 predicted 1461
8 SASI_Hs01_00154961 predicted 1274
9 SASI_Hs01_00154962 predicted 1499
10 SASI_Hs01_00154963 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169203 predicted 1339
2 SASI_Hs01_00169204 predicted 1119
3 SASI_Hs01_00169205 predicted 1295
4 SASI_Hs01_00169206 predicted 315
5 SASI_Hs01_00169207 predicted 1441
6 SASI_Hs01_00169208 predicted 319
7 SASI_Hs01_00169209 predicted 1297
8 SASI_Hs01_00169210 predicted 1109
9 SASI_Hs01_00169211 predicted 1334
10 SASI_Hs01_00169212 predicted 1398
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312952 predicted 301
2 SASI_Rn02_00312953 predicted 319
3 SASI_Rn02_00312954 predicted 377
4 SASI_Rn02_00312955 predicted 303
5 SASI_Rn02_00312956 predicted 264
6 SASI_Rn02_00312957 predicted 267
7 SASI_Rn02_00312958 predicted 327
8 SASI_Rn02_00312959 predicted 374
9 SASI_Rn02_00312960 predicted 257
10 SASI_Rn02_00312961 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041618 predicted 899
2 SASI_Mm01_00041614 predicted 799
3 SASI_Mm01_00041615 predicted 553
4 SASI_Mm01_00041616 predicted 289
5 SASI_Mm01_00041617 predicted 1259
6 SASI_Mm02_00349221 predicted 953
7 SASI_Mm01_00041619 predicted 636
8 SASI_Mm01_00041620 predicted 1005
9 SASI_Mm01_00041622 predicted 1011
10 SASI_Mm01_00041623 predicted 1267
11 SASI_Mm01_00041621 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022568
ALDH8A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 8 family, member A1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1027s1c1
Sequence:CCGGGCATAGGTGCTCTGATAAGTACTCGAGTACTTATCAGAGCACCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1177s1c1
Sequence:CCGGCCACGGTGATAACAGACATTACTCGAGTAATGTCTGTTATCACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-323s1c1
Sequence:CCGGCGAGTCTAAAGACCAAGGGAACTCGAGTTCCCTTGGTCTTTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1476s1c1
Sequence:CCGGGACTTCTTCACTGAGATCAAACTCGAGTTTGATCTCAGTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-620s1c1
Sequence:CCGGGTTGTGCAAACTCCTGGATAACTCGAGTTATCCAGGAGTTTGCACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022568
ALDH8A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 8 family, member A1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1027s1c1
Sequence:CCGGGCATAGGTGCTCTGATAAGTACTCGAGTACTTATCAGAGCACCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1177s1c1
Sequence:CCGGCCACGGTGATAACAGACATTACTCGAGTAATGTCTGTTATCACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-323s1c1
Sequence:CCGGCGAGTCTAAAGACCAAGGGAACTCGAGTTCCCTTGGTCTTTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1476s1c1
Sequence:CCGGGACTTCTTCACTGAGATCAAACTCGAGTTTGATCTCAGTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-620s1c1
Sequence:CCGGGTTGTGCAAACTCCTGGATAACTCGAGTTATCCAGGAGTTTGCACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022568
ALDH8A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 8 family, member A1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1027s1c1
Sequence:CCGGGCATAGGTGCTCTGATAAGTACTCGAGTACTTATCAGAGCACCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1177s1c1
Sequence:CCGGCCACGGTGATAACAGACATTACTCGAGTAATGTCTGTTATCACCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-323s1c1
Sequence:CCGGCGAGTCTAAAGACCAAGGGAACTCGAGTTCCCTTGGTCTTTAGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-1476s1c1
Sequence:CCGGGACTTCTTCACTGAGATCAAACTCGAGTTTGATCTCAGTGAAGAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022568.2-620s1c1
Sequence:CCGGGTTGTGCAAACTCCTGGATAACTCGAGTTATCCAGGAGTTTGCACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178713
ALDH8A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 8 family, member A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1240s1c1
Sequence:CCGGCGTGTGTTGTTCCGTTTGATACTCGAGTATCAAACGGAACAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1279s1c1
Sequence:CCGGCGAGAGCTAACAGTGTTAGATCTCGAGATCTAACACTGTTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-506s1c1
Sequence:CCGGCCCTTGGAATTTACCACTCTACTCGAGTAGAGTGGTAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-978s1c1
Sequence:CCGGGCTACCAGAAAGTGGAAAGTTCTCGAGAACTTTCCACTTTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-648s1c1
Sequence:CCGGCCACCAGGTGTGATCAACATTCTCGAGAATGTTGATCACACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178713
ALDH8A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 8 family, member A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1240s1c1
Sequence:CCGGCGTGTGTTGTTCCGTTTGATACTCGAGTATCAAACGGAACAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1279s1c1
Sequence:CCGGCGAGAGCTAACAGTGTTAGATCTCGAGATCTAACACTGTTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-506s1c1
Sequence:CCGGCCCTTGGAATTTACCACTCTACTCGAGTAGAGTGGTAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-978s1c1
Sequence:CCGGGCTACCAGAAAGTGGAAAGTTCTCGAGAACTTTCCACTTTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-648s1c1
Sequence:CCGGCCACCAGGTGTGATCAACATTCTCGAGAATGTTGATCACACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178713
ALDH8A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 8 family, member A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1240s1c1
Sequence:CCGGCGTGTGTTGTTCCGTTTGATACTCGAGTATCAAACGGAACAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-1279s1c1
Sequence:CCGGCGAGAGCTAACAGTGTTAGATCTCGAGATCTAACACTGTTAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-506s1c1
Sequence:CCGGCCCTTGGAATTTACCACTCTACTCGAGTAGAGTGGTAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-978s1c1
Sequence:CCGGGCTACCAGAAAGTGGAAAGTTCTCGAGAACTTTCCACTTTCTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178713.3-648s1c1
Sequence:CCGGCCACCAGGTGTGATCAACATTCTCGAGAATGTTGATCACACCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks