EMAIL THIS PAGE TO A FRIEND

ALDH9A1

aldehyde dehydrogenase 9 family, member A1

48 Gene Product Result for
Synonyms: ALDH4 ALDH7 ALDH9 E3 TMABADH
UniProtKB ID: P49189, B2R6X1, Q5VV90, Q6LCL1, Q9NZT7
Gene ID:
Human(223) Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. It has a high activity for oxidation of gamma-aminobutyraldehyde and other amino aldehydes. The enzyme catalyzes the dehydrogenation of gamma-aminobutyraldehyde to gamma-aminobutyric acid (GABA). This isozyme is a tetramer of identical 54-kD subunits. [provided by RefSeq, Jul 2008]
Mouse(56752) aldehyde dehydrogenase 9, subfamily A1
Rat(64040) aldehyde dehydrogenase 9 family, member A1
naked mole-rat(101717741) aldehyde dehydrogenase 9 family, member A1
domestic guinea pig(100732288) aldehyde dehydrogenase 9 family, member A1
sheep(101109411) aldehyde dehydrogenase 9 family, member A1
chicken(424405) aldehyde dehydrogenase 9 family, member A1
cow(537539) aldehyde dehydrogenase 9 family, member A1
Horse(100060577) aldehyde dehydrogenase 9 family, member A1
domestic cat(101080506) aldehyde dehydrogenase 9 family, member A1
dog(478991) aldehyde dehydrogenase 9 family, member A1
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000696 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069511 MISSION® esiRNA esiRNA human ALDH9A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000696 Rosetta Predictions human pricing
NM_022273 Rosetta Predictions rat pricing
NM_019993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220410 predicted 943
2 SASI_Hs01_00220411 predicted 1032
3 SASI_Hs01_00220412 predicted 1211
4 SASI_Hs01_00220413 predicted 972
5 SASI_Hs01_00220414 predicted 706
6 SASI_Hs01_00220415 predicted 648
7 SASI_Hs01_00220416 predicted 735
8 SASI_Hs01_00220417 predicted 291
9 SASI_Hs01_00220418 predicted 725
10 SASI_Hs01_00220419 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093343 predicted 1088
2 SASI_Rn01_00093344 predicted 960
3 SASI_Rn01_00093345 predicted 1615
4 SASI_Rn01_00093346 predicted 286
5 SASI_Rn01_00093347 predicted 311
6 SASI_Rn01_00093348 predicted 1653
7 SASI_Rn01_00093349 predicted 981
8 SASI_Rn01_00093350 predicted 936
9 SASI_Rn01_00093351 predicted 338
10 SASI_Rn01_00093352 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325334 predicted 1335
2 SASI_Mm01_00096875 predicted 465
3 SASI_Mm01_00096876 predicted 832
4 SASI_Mm01_00096877 predicted 1856
5 SASI_Mm01_00096879 predicted 1082
6 SASI_Mm01_00096881 predicted 1052
7 SASI_Mm01_00096882 predicted 1182
8 SASI_Mm01_00096883 predicted 431
9 SASI_Mm01_00096884 predicted 554
10 SASI_Mm02_00325335 predicted 1650
11 SASI_Mm01_00096878 predicted 222
12 SASI_Mm01_00096880 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019993
VALIDATED
ALDH9A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 9 family, member A1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1325s1c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-621s1c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-888s1c1
Sequence:CCGGTCAGACTGTAATATGGAGAATCTCGAGATTCTCCATATTACAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-261s1c1
Sequence:CCGGGAGAATGCAAAGGCTGCCTTTCTCGAGAAAGGCAGCCTTTGCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1115s1c1
Sequence:CCGGCGGGTTTGTCAAGTTGGCAAACTCGAGTTTGCCAACTTGACAAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1548s21c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-611s21c1
Sequence:CCGGACAACGGGAAGTCCATATTTGCTCGAGCAAATATGGACTTCCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1057s21c1
Sequence:CCGGGGAGTCAAGCCCATTACTTTGCTCGAGCAAAGTAATGGGCTTGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1887s21c1
Sequence:CCGGATCCAGGCTTTGGGTCATTAGCTCGAGCTAATGACCCAAAGCCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019993.3-844s21c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019993
VALIDATED
ALDH9A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 9 family, member A1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1325s1c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-621s1c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-888s1c1
Sequence:CCGGTCAGACTGTAATATGGAGAATCTCGAGATTCTCCATATTACAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-261s1c1
Sequence:CCGGGAGAATGCAAAGGCTGCCTTTCTCGAGAAAGGCAGCCTTTGCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1115s1c1
Sequence:CCGGCGGGTTTGTCAAGTTGGCAAACTCGAGTTTGCCAACTTGACAAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1548s21c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-611s21c1
Sequence:CCGGACAACGGGAAGTCCATATTTGCTCGAGCAAATATGGACTTCCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1057s21c1
Sequence:CCGGGGAGTCAAGCCCATTACTTTGCTCGAGCAAAGTAATGGGCTTGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1887s21c1
Sequence:CCGGATCCAGGCTTTGGGTCATTAGCTCGAGCTAATGACCCAAAGCCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019993.3-844s21c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019993
VALIDATED
ALDH9A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 9 family, member A1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1325s1c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-621s1c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-888s1c1
Sequence:CCGGTCAGACTGTAATATGGAGAATCTCGAGATTCTCCATATTACAGTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-261s1c1
Sequence:CCGGGAGAATGCAAAGGCTGCCTTTCTCGAGAAAGGCAGCCTTTGCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019993.2-1115s1c1
Sequence:CCGGCGGGTTTGTCAAGTTGGCAAACTCGAGTTTGCCAACTTGACAAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1548s21c1
Sequence:CCGGGCGAGCTAATGACACCACTTTCTCGAGAAAGTGGTGTCATTAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-611s21c1
Sequence:CCGGACAACGGGAAGTCCATATTTGCTCGAGCAAATATGGACTTCCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1057s21c1
Sequence:CCGGGGAGTCAAGCCCATTACTTTGCTCGAGCAAAGTAATGGGCTTGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305148    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019993.3-1887s21c1
Sequence:CCGGATCCAGGCTTTGGGTCATTAGCTCGAGCTAATGACCCAAAGCCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019993.3-844s21c1
Sequence:CCGGGCCATGATCTTTAAGCCTTCTCTCGAGAGAAGGCTTAAAGATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000696
VALIDATED
ALDH9A1 MISSION shRNA Bacterial Glycerol Stock
aldehyde dehydrogenase 9 family, member A1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000696.2-615s1c1
Sequence:CCGGGCTGCCAGGATAATAAGGGAACTCGAGTTCCCTTATTATCCTGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1470s1c1
Sequence:CCGGCCCAAATTAAAGGATGGATATCTCGAGATATCCATCCTTTAATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-882s1c1
Sequence:CCGGCCAGCATTAGCCTGTGGTAATCTCGAGATTACCACAGGCTAATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1788s1c1
Sequence:CCGGCGTGTGACAATCGAATATTATCTCGAGATAATATTCGATTGTCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1702s1c1
Sequence:CCGGCGTGCTTCATTAACAACTATACTCGAGTATAGTTGTTAATGAAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1988s21c1
Sequence:GTACCGGTGTTAATTCTCTGGCGTATTTCTCGAGAAATACGCCAGAGAATTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1586s21c1
Sequence:CCGGGCCGTGTGACAATCGAATATTCTCGAGAATATTCGATTGTCACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1540s21c1
Sequence:CCGGTTGCCCTTTGGTGGATATAAGCTCGAGCTTATATCCACCAAAGGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-494s21c1
Sequence:CCGGCCCGCTTGGACATTGACATTTCTCGAGAAATGTCAATGTCCAAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1430s21c1
Sequence:CCGGGACTAGCAGCTGGCGTCTTTACTCGAGTAAAGACGCCAGCTGCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000696
VALIDATED
ALDH9A1 MISSION shRNA shRNA Plasmid DNA
aldehyde dehydrogenase 9 family, member A1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000696.2-615s1c1
Sequence:CCGGGCTGCCAGGATAATAAGGGAACTCGAGTTCCCTTATTATCCTGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1470s1c1
Sequence:CCGGCCCAAATTAAAGGATGGATATCTCGAGATATCCATCCTTTAATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-882s1c1
Sequence:CCGGCCAGCATTAGCCTGTGGTAATCTCGAGATTACCACAGGCTAATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1788s1c1
Sequence:CCGGCGTGTGACAATCGAATATTATCTCGAGATAATATTCGATTGTCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1702s1c1
Sequence:CCGGCGTGCTTCATTAACAACTATACTCGAGTATAGTTGTTAATGAAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1988s21c1
Sequence:GTACCGGTGTTAATTCTCTGGCGTATTTCTCGAGAAATACGCCAGAGAATTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1586s21c1
Sequence:CCGGGCCGTGTGACAATCGAATATTCTCGAGAATATTCGATTGTCACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1540s21c1
Sequence:CCGGTTGCCCTTTGGTGGATATAAGCTCGAGCTTATATCCACCAAAGGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-494s21c1
Sequence:CCGGCCCGCTTGGACATTGACATTTCTCGAGAAATGTCAATGTCCAAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1430s21c1
Sequence:CCGGGACTAGCAGCTGGCGTCTTTACTCGAGTAAAGACGCCAGCTGCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000696
VALIDATED
ALDH9A1 MISSION shRNA Lentiviral Transduction Particles
aldehyde dehydrogenase 9 family, member A1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000696.2-615s1c1
Sequence:CCGGGCTGCCAGGATAATAAGGGAACTCGAGTTCCCTTATTATCCTGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1470s1c1
Sequence:CCGGCCCAAATTAAAGGATGGATATCTCGAGATATCCATCCTTTAATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-882s1c1
Sequence:CCGGCCAGCATTAGCCTGTGGTAATCTCGAGATTACCACAGGCTAATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1788s1c1
Sequence:CCGGCGTGTGACAATCGAATATTATCTCGAGATAATATTCGATTGTCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000696.2-1702s1c1
Sequence:CCGGCGTGCTTCATTAACAACTATACTCGAGTATAGTTGTTAATGAAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1988s21c1
Sequence:GTACCGGTGTTAATTCTCTGGCGTATTTCTCGAGAAATACGCCAGAGAATTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1586s21c1
Sequence:CCGGGCCGTGTGACAATCGAATATTCTCGAGAATATTCGATTGTCACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1540s21c1
Sequence:CCGGTTGCCCTTTGGTGGATATAAGCTCGAGCTTATATCCACCAAAGGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230573    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-494s21c1
Sequence:CCGGCCCGCTTGGACATTGACATTTCTCGAGAAATGTCAATGTCCAAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000696.3-1430s21c1
Sequence:CCGGGACTAGCAGCTGGCGTCTTTACTCGAGTAAAGACGCCAGCTGCTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)