EMAIL THIS PAGE TO A FRIEND

ALDOA

aldolase A, fructose-bisphosphate

112 Gene Product Result for
Synonyms: ALDA GSD12
Gene ID:
Human(226) Summary: The protein encoded by this gene, Aldolase A (fructose-bisphosphate aldolase), is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. Three aldolase isozymes (A, B, and C), encoded by three different genes, are differentially expressed during development. Aldolase A is found in the developing embryo and is produced in even greater amounts in adult muscle. Aldolase A expression is repressed in adult liver, kidney and intestine and similar to aldolase C levels in brain and other nervous tissue. Aldolase A deficiency has been associated with myopathy and hemolytic anemia. Alternative splicing and alternative promoter usage results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 10. [provided by RefSeq, Aug 2011]
Mouse(11674) aldolase A, fructose-bisphosphate
Rat(24189) aldolase A, fructose-bisphosphate
chicken(396078) aldolase A, fructose-bisphosphate
dog(479787) aldolase A, fructose-bisphosphate
domestic cat(101100776) aldolase A, fructose-bisphosphate
cow(509566) aldolase A, fructose-bisphosphate
Horse(100066121) aldolase A, fructose-bisphosphate
sheep(443085) aldolase A, fructose-bisphosphate
Domestic Rabbit(100009055) aldolase A, fructose-bisphosphate
domestic guinea pig(100730400) aldolase A, fructose-bisphosphate
naked mole-rat(101702582) aldolase A, fructose-bisphosphate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK223 Aldolase Activity Colorimetric Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000034 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000034 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000034 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000034 Rosetta Predictions human pricing
NM_184041 Rosetta Predictions human pricing
NM_184043 Rosetta Predictions human pricing
NM_012495 Rosetta Predictions rat pricing
NM_007438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211472 predicted 1796
2 SASI_Hs01_00211474 predicted 1228
3 SASI_Hs01_00211476 predicted 1261
4 SASI_Hs02_00301712 predicted 1231
5 SASI_Hs02_00301713 predicted 1606
6 SASI_Hs02_00301714 predicted 1650
7 SASI_Hs02_00301715 predicted 1646
8 SASI_Hs02_00301716 predicted 1443
9 SASI_Hs02_00301717 predicted 2079
10 SASI_Hs02_00301718 predicted 2081
11 SASI_Hs01_00211473 predicted 1363
12 SASI_Hs01_00211475 predicted 2086
13 SASI_Hs01_00211477 predicted 1505
14 SASI_Hs01_00211478 predicted 1384
15 SASI_Hs01_00211479 predicted 1844
16 SASI_Hs01_00211480 predicted 1317
17 SASI_Hs01_00211481 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171859 predicted 1016
2 SASI_Hs01_00171861 predicted 446
3 SASI_Hs01_00171863 predicted 483
4 SASI_Hs02_00371334 predicted 454
5 SASI_Hs02_00371335 predicted 826
6 SASI_Hs02_00371336 predicted 872
7 SASI_Hs02_00371337 predicted 870
8 SASI_Hs02_00371338 predicted 663
9 SASI_Hs02_00371339 predicted 1292
10 SASI_Hs02_00371340 predicted 1302
11 SASI_Hs01_00171860 predicted 579
12 SASI_Hs01_00171862 predicted 1299
13 SASI_Hs01_00171864 predicted 730
14 SASI_Hs01_00171865 predicted 601
15 SASI_Hs01_00171866 predicted 1065
16 SASI_Hs01_00171867 predicted 539
17 SASI_Hs01_00171868 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217666 predicted 1032
2 SASI_Hs01_00217668 predicted 467
3 SASI_Hs01_00217670 predicted 501
4 SASI_Hs02_00371341 predicted 469
5 SASI_Hs02_00371342 predicted 850
6 SASI_Hs02_00371343 predicted 891
7 SASI_Hs02_00371344 predicted 894
8 SASI_Hs02_00371345 predicted 690
9 SASI_Hs02_00371346 predicted 1312
10 SASI_Hs02_00371347 predicted 1315
11 SASI_Hs01_00217667 predicted 597
12 SASI_Hs01_00217669 predicted 1319
13 SASI_Hs01_00217671 predicted 748
14 SASI_Hs01_00217672 predicted 629
15 SASI_Hs01_00217673 predicted 1089
16 SASI_Hs01_00217674 predicted 559
17 SASI_Hs01_00217675 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049776 predicted 916
2 SASI_Rn01_00049777 predicted 915
3 SASI_Rn01_00049779 predicted 1213
4 SASI_Rn01_00049780 predicted 806
5 SASI_Rn01_00049781 predicted 600
6 SASI_Rn01_00049782 predicted 722
7 SASI_Rn02_00259536 predicted 837
8 SASI_Rn01_00049783 predicted 402
9 SASI_Rn01_00049784 predicted 709
10 SASI_Rn01_00049785 predicted 663
11 SASI_Rn01_00049778 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058380 predicted 745
2 SASI_Mm01_00058381 predicted 1330
3 SASI_Mm01_00058382 predicted 1367
4 SASI_Mm01_00058383 predicted 1246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000034
VALIDATED
ALDOA MISSION shRNA Bacterial Glycerol Stock
aldolase A, fructose-bisphosphate
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1449s21c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1718s21c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2015s21c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2081s21c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-2081s1c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1449s1c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-2015s1c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1718s1c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-1609s1c1
Sequence:CCGGGCTGCCAGTATGTGACCGAGACTCGAGTCTCGGTCACATACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000034
VALIDATED
ALDOA MISSION shRNA shRNA Plasmid DNA
aldolase A, fructose-bisphosphate
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1449s21c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1718s21c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2015s21c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2081s21c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-2081s1c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1449s1c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-2015s1c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1718s1c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-1609s1c1
Sequence:CCGGGCTGCCAGTATGTGACCGAGACTCGAGTCTCGGTCACATACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000034
VALIDATED
ALDOA MISSION shRNA Lentiviral Transduction Particles
aldolase A, fructose-bisphosphate
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1449s21c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-1718s21c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2015s21c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000034.2-2081s21c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-2081s1c1
Sequence:CCGGCGTCTCTAACCACGCCTATTACTCGAGTAATAGGCGTGGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1449s1c1
Sequence:CCGGTGGCGTTGTGTGCTGAAGATTCTCGAGAATCTTCAGCACACAACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-2015s1c1
Sequence:CCGGCCTTGCCTGTCAAGGAAAGTACTCGAGTACTTTCCTTGACAGGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000034.2-1718s1c1
Sequence:CCGGCCATGCTTGCACTCAGAAGTTCTCGAGAACTTCTGAGTGCAAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000034.2-1609s1c1
Sequence:CCGGGCTGCCAGTATGTGACCGAGACTCGAGTCTCGGTCACATACTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007438
VALIDATED
ALDOA MISSION shRNA Bacterial Glycerol Stock
aldolase A, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-998s21c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007438.3-1410s21c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-662s21c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-566s21c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007438.3-1410s1c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-662s1c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-998s1c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-472s1c1
Sequence:CCGGTGTGGGCATTAAGGTAGATAACTCGAGTTATCTACCTTAATGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-566s1c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007438
VALIDATED
ALDOA MISSION shRNA shRNA Plasmid DNA
aldolase A, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-998s21c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007438.3-1410s21c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-662s21c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-566s21c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007438.3-1410s1c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-662s1c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-998s1c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-472s1c1
Sequence:CCGGTGTGGGCATTAAGGTAGATAACTCGAGTTATCTACCTTAATGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-566s1c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007438
VALIDATED
ALDOA MISSION shRNA Lentiviral Transduction Particles
aldolase A, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-998s21c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314252    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007438.3-1410s21c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-662s21c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007438.3-566s21c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115276    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007438.3-1410s1c1
Sequence:CCGGCCACTGCCAATAAACAACTATCTCGAGATAGTTGTTTATTGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-662s1c1
Sequence:CCGGGCCAATGTTCTGGCCCGTTATCTCGAGATAACGGGCCAGAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-998s1c1
Sequence:CCGGGCATCCATCAACCTCAATGCTCTCGAGAGCATTGAGGTTGATGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-472s1c1
Sequence:CCGGTGTGGGCATTAAGGTAGATAACTCGAGTTATCTACCTTAATGCCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007438.3-566s1c1
Sequence:CCGGGCCCAGTATAAGAAGGATGGACTCGAGTCCATCCTTCTTATACTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks