EMAIL THIS PAGE TO A FRIEND

ALDOB

aldolase B, fructose-bisphosphate

89 Gene Product Result for
Synonyms: ALDB ALDO2
UniProtKB ID: P05062, Q13741, Q13742, Q5T7D6
Gene ID:
Human(229) Summary: Fructose-1,6-bisphosphate aldolase (EC 4.1.2.13) is a tetrameric glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. Vertebrates have 3 aldolase isozymes which are distinguished by their electrophoretic and catalytic properties. Differences indicate that aldolases A, B, and C are distinct proteins, the products of a family of related 'housekeeping' genes exhibiting developmentally regulated expression of the different isozymes. The developing embryo produces aldolase A, which is produced in even greater amounts in adult muscle where it can be as much as 5% of total cellular protein. In adult liver, kidney and intestine, aldolase A expression is repressed and aldolase B is produced. In brain and other nervous tissue, aldolase A and C are expressed about equally. There is a high degree of homology between aldolase A and C. Defects in ALDOB cause hereditary fructose intolerance. [provided by RefSeq, Dec 2008]
Mouse(230163) aldolase B, fructose-bisphosphate
Rat(24190) aldolase B, fructose-bisphosphate
domestic guinea pig(100720708) aldolase B, fructose-bisphosphate
naked mole-rat(101713582) aldolase B, fructose-bisphosphate
sheep(443440) aldolase B, fructose-bisphosphate
Domestic Rabbit(100328925) aldolase B, fructose-bisphosphate
Zebrafish(321664) aldolase b, fructose-bisphosphate
cow(515263) aldolase B, fructose-bisphosphate
Horse(100054480) aldolase B, fructose-bisphosphate
domestic cat(101097025) aldolase B, fructose-bisphosphate
dog(474787) aldolase B, fructose-bisphosphate
chicken(427308) aldolase B, fructose-bisphosphate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK223 Aldolase Activity Colorimetric Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000035 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001201 MISSION® esiRNA esiRNA targeting human ALDOB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000035 Rosetta Predictions human pricing
NM_012496 Rosetta Predictions rat pricing
NM_144903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138014 predicted 765
2 SASI_Hs01_00138015 predicted 864
3 SASI_Hs01_00138016 predicted 657
4 SASI_Hs01_00138017 predicted 722
5 SASI_Hs01_00138018 predicted 842
6 SASI_Hs01_00138019 predicted 657
7 SASI_Hs01_00138020 predicted 882
8 SASI_Hs01_00138021 predicted 1293
9 SASI_Hs01_00138022 predicted 882
10 SASI_Hs02_00301719 predicted 842
11 SASI_Hs01_00138023 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259537 predicted 1222
2 SASI_Rn01_00090603 predicted 357
3 SASI_Rn01_00090605 predicted 695
4 SASI_Rn01_00090606 predicted 591
5 SASI_Rn02_00259538 predicted 780
6 SASI_Rn01_00090609 predicted 892
7 SASI_Rn01_00090608 predicted 328
8 SASI_Rn02_00259539 predicted 1225
9 SASI_Rn01_00090610 predicted 883
10 SASI_Rn02_00259540 predicted 691
11 SASI_Rn01_00090604 predicted 252
12 SASI_Rn01_00090607 predicted 1248
13 SASI_Rn01_00090611 predicted 793
14 SASI_Rn01_00090612 predicted 1233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020820 predicted 360
2 SASI_Mm01_00020821 predicted 726
3 SASI_Mm01_00020822 predicted 1208
4 SASI_Mm02_00340372 predicted 700
5 SASI_Mm02_00340373 predicted 358
6 SASI_Mm01_00020823 predicted 897
7 SASI_Mm02_00340374 predicted 727
8 SASI_Mm01_00020825 predicted 238
9 SASI_Mm01_00020826 predicted 887
10 SASI_Mm01_00020827 predicted 686
11 SASI_Mm01_00020824 predicted 216
12 SASI_Mm01_00020828 predicted 1233
13 SASI_Mm01_00020829 predicted 1243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144903
VALIDATED
ALDOB MISSION shRNA Bacterial Glycerol Stock
aldolase B, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-469s1c1
Sequence:CCGGCAGTACAAGAAAGATGGAGTTCTCGAGAACTCCATCTTTCTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-326s1c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-887s1c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144903.2-327s1c1
Sequence:CCGGCCAGGGAAATCTGTTCAGAAACTCGAGTTTCTGAACAGATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-1222s1c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-887s21c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-326s21c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-1134s21c1
Sequence:CCGGCACAGCCTCCTACACCTATTACTCGAGTAATAGGTGTAGGAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144903.2-1222s21c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144903
VALIDATED
ALDOB MISSION shRNA shRNA Plasmid DNA
aldolase B, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-469s1c1
Sequence:CCGGCAGTACAAGAAAGATGGAGTTCTCGAGAACTCCATCTTTCTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-326s1c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-887s1c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144903.2-327s1c1
Sequence:CCGGCCAGGGAAATCTGTTCAGAAACTCGAGTTTCTGAACAGATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-1222s1c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-887s21c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-326s21c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-1134s21c1
Sequence:CCGGCACAGCCTCCTACACCTATTACTCGAGTAATAGGTGTAGGAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144903.2-1222s21c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144903
VALIDATED
ALDOB MISSION shRNA Lentiviral Transduction Particles
aldolase B, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-469s1c1
Sequence:CCGGCAGTACAAGAAAGATGGAGTTCTCGAGAACTCCATCTTTCTTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-326s1c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-887s1c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144903.2-327s1c1
Sequence:CCGGCCAGGGAAATCTGTTCAGAAACTCGAGTTTCTGAACAGATTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144903.2-1222s1c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-887s21c1
Sequence:CCGGGTGAGGAGGATGCTACACTTACTCGAGTAAGTGTAGCATCCTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-326s21c1
Sequence:CCGGGCCAGGGAAATCTGTTCAGAACTCGAGTTCTGAACAGATTTCCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144903.2-1134s21c1
Sequence:CCGGCACAGCCTCCTACACCTATTACTCGAGTAATAGGTGTAGGAGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144903.2-1222s21c1
Sequence:CCGGCCCTGGAAATTAGATAACATTCTCGAGAATGTTATCTAATTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000035
ALDOB MISSION shRNA Bacterial Glycerol Stock
aldolase B, fructose-bisphosphate
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1009s1c1
Sequence:CCGGCCTGGAAACTAAGTTTCTCTTCTCGAGAAGAGAAACTTAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-173s1c1
Sequence:CCGGCTCAGAAATTGCCCAGAGCATCTCGAGATGCTCTGGGCAATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1147s1c1
Sequence:CCGGGACAGTATGTTCACACGGGTTCTCGAGAACCCGTGTGAACATACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-438s1c1
Sequence:CCGGGTGGGAATCAAGTTAGACCAACTCGAGTTGGTCTAACTTGATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-678s1c1
Sequence:CCGGCCTATTGTTGAACCAGAGGTACTCGAGTACCTCTGGTTCAACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1283s21c1
Sequence:CCGGTGGAAATACAACACATGTTAACTCGAGTTAACATGTGTTGTATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1487s21c1
Sequence:CCGGGCTGATTGAAACACCTCATTACTCGAGTAATGAGGTGTTTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000035
ALDOB MISSION shRNA shRNA Plasmid DNA
aldolase B, fructose-bisphosphate
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1009s1c1
Sequence:CCGGCCTGGAAACTAAGTTTCTCTTCTCGAGAAGAGAAACTTAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-173s1c1
Sequence:CCGGCTCAGAAATTGCCCAGAGCATCTCGAGATGCTCTGGGCAATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1147s1c1
Sequence:CCGGGACAGTATGTTCACACGGGTTCTCGAGAACCCGTGTGAACATACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-438s1c1
Sequence:CCGGGTGGGAATCAAGTTAGACCAACTCGAGTTGGTCTAACTTGATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-678s1c1
Sequence:CCGGCCTATTGTTGAACCAGAGGTACTCGAGTACCTCTGGTTCAACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1283s21c1
Sequence:CCGGTGGAAATACAACACATGTTAACTCGAGTTAACATGTGTTGTATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1487s21c1
Sequence:CCGGGCTGATTGAAACACCTCATTACTCGAGTAATGAGGTGTTTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000035
ALDOB MISSION shRNA Lentiviral Transduction Particles
aldolase B, fructose-bisphosphate
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1009s1c1
Sequence:CCGGCCTGGAAACTAAGTTTCTCTTCTCGAGAAGAGAAACTTAGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-173s1c1
Sequence:CCGGCTCAGAAATTGCCCAGAGCATCTCGAGATGCTCTGGGCAATTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-1147s1c1
Sequence:CCGGGACAGTATGTTCACACGGGTTCTCGAGAACCCGTGTGAACATACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-438s1c1
Sequence:CCGGGTGGGAATCAAGTTAGACCAACTCGAGTTGGTCTAACTTGATTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000035.2-678s1c1
Sequence:CCGGCCTATTGTTGAACCAGAGGTACTCGAGTACCTCTGGTTCAACAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1283s21c1
Sequence:CCGGTGGAAATACAACACATGTTAACTCGAGTTAACATGTGTTGTATTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000035.3-1487s21c1
Sequence:CCGGGCTGATTGAAACACCTCATTACTCGAGTAATGAGGTGTTTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks