EMAIL THIS PAGE TO A FRIEND

ALDOC

aldolase C, fructose-bisphosphate

79 Gene Product Result for
Synonyms: ALDC
UniProtKB ID: P09972, B2R5R3, Q3SYL3, Q6FH94, Q6P0L5
Gene ID:
Human(230) Summary: This gene encodes a member of the class I fructose-biphosphate aldolase gene family. Expressed specifically in the hippocampus and Purkinje cells of the brain, the encoded protein is a glycolytic enzyme that catalyzes the reversible aldol cleavage of fructose-1,6-biphosphate and fructose 1-phosphate to dihydroxyacetone phosphate and either glyceraldehyde-3-phosphate or glyceraldehyde, respectively. [provided by RefSeq, Jul 2008]
Mouse(11676) aldolase C, fructose-bisphosphate
Rat(24191) aldolase C, fructose-bisphosphate
chicken(395492) aldolase C, fructose-bisphosphate
cow(504584) aldolase C, fructose-bisphosphate
Horse(100059231) aldolase C, fructose-bisphosphate
domestic cat(101098666) aldolase C, fructose-bisphosphate
dog(480622) aldolase C, fructose-bisphosphate
sheep(101105422) aldolase C, fructose-bisphosphate
Domestic Rabbit(100346653) aldolase C, fructose-bisphosphate
naked mole-rat(101710490) aldolase C, fructose-bisphosphate
domestic guinea pig(100725840) aldolase C, fructose-bisphosphate
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003282 Anti-ALDOC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV48273 Anti-ALDOC antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, bovine, mouse, rat, zebrafish, rabbit, rabbit
western blot pricing
SAB2100103 Anti-ALDOC antibody produced in rabbit affinity isolated antibody guinea pig, zebrafish, mouse, rat, bovine, rabbit, human, horse
western blot pricing
SAB4500925 Anti-ALDOC antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing

Kits

Product # Description Species Add to Cart
 
MAK223 Aldolase Activity Colorimetric Assay Kit Sufficient for 100 Colorimetric tests human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0936 AQUA Peptide TPSALAILENANVLA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005165 Rosetta Predictions human pricing
NM_012497 Rosetta Predictions rat pricing
NM_009657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038975 predicted 1308
2 SASI_Hs01_00038976 predicted 386
3 SASI_Hs01_00038977 predicted 739
4 SASI_Hs01_00038978 predicted 729
5 SASI_Hs01_00038979 predicted 485
6 SASI_Hs01_00038980 predicted 966
7 SASI_Hs01_00038981 predicted 732
8 SASI_Hs01_00038982 predicted 412
9 SASI_Hs01_00038983 predicted 691
10 SASI_Hs01_00038984 predicted 642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041834 predicted 345
2 SASI_Rn01_00041835 predicted 748
3 SASI_Rn01_00041836 predicted 745
4 SASI_Rn01_00041837 predicted 765
5 SASI_Rn01_00041839 predicted 588
6 SASI_Rn01_00041841 predicted 689
7 SASI_Rn01_00041842 predicted 1326
8 SASI_Rn02_00259541 predicted 290
9 SASI_Rn01_00041843 predicted 607
10 SASI_Rn02_00259542 predicted 1221
11 SASI_Rn01_00041838 predicted 1288
12 SASI_Rn01_00041840 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200550 predicted 1037
2 SASI_Mm01_00200551 predicted 450
3 SASI_Mm01_00200552 predicted 639
4 SASI_Mm01_00200553 predicted 246
5 SASI_Mm01_00200554 predicted 205
6 SASI_Mm01_00200555 predicted 797
7 SASI_Mm01_00200556 predicted 1223
8 SASI_Mm01_00200557 predicted 1376
9 SASI_Mm01_00200558 predicted 741
10 SASI_Mm01_00200559 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005165
VALIDATED
ALDOC MISSION shRNA Bacterial Glycerol Stock
aldolase C, fructose-bisphosphate
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005165.2-1403s21c1
Sequence:CCGGGACCATAGGATGGGAGGATAGCTCGAGCTATCCTCCCATCCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-197s21c1
Sequence:CCGGGACATTGCCCTGCGGATTGTACTCGAGTACAATCCGCAGGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-360s21c1
Sequence:CCGGAGTGCATTGGAGGCGTCATTTCTCGAGAAATGACGCCTCCAATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-541s21c1
Sequence:CCGGAGAACGCTGTGCCCAATACAACTCGAGTTGTATTGGGCACAGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-610s1c1
Sequence:CCGGCTATTGTGGAACCTGAAATATCTCGAGATATTTCAGGTTCCACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005165.1-1113s1c1
Sequence:CCGGGCAGCACAGTCACTCTACATTCTCGAGAATGTAGAGTGACTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-647s1c1
Sequence:CCGGCGACCTCAAACGTTGTCAGTACTCGAGTACTGACAACGTTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-880s1c1
Sequence:CCGGAGAGCGAAGAAGAGGCATCATCTCGAGATGATGCCTCTTCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-306s1c1
Sequence:CCGGCTCTACCAGAAAGATGATAATCTCGAGATTATCATCTTTCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005165
VALIDATED
ALDOC MISSION shRNA shRNA Plasmid DNA
aldolase C, fructose-bisphosphate
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005165.2-1403s21c1
Sequence:CCGGGACCATAGGATGGGAGGATAGCTCGAGCTATCCTCCCATCCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-197s21c1
Sequence:CCGGGACATTGCCCTGCGGATTGTACTCGAGTACAATCCGCAGGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-360s21c1
Sequence:CCGGAGTGCATTGGAGGCGTCATTTCTCGAGAAATGACGCCTCCAATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-541s21c1
Sequence:CCGGAGAACGCTGTGCCCAATACAACTCGAGTTGTATTGGGCACAGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-610s1c1
Sequence:CCGGCTATTGTGGAACCTGAAATATCTCGAGATATTTCAGGTTCCACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005165.1-1113s1c1
Sequence:CCGGGCAGCACAGTCACTCTACATTCTCGAGAATGTAGAGTGACTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-647s1c1
Sequence:CCGGCGACCTCAAACGTTGTCAGTACTCGAGTACTGACAACGTTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-880s1c1
Sequence:CCGGAGAGCGAAGAAGAGGCATCATCTCGAGATGATGCCTCTTCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-306s1c1
Sequence:CCGGCTCTACCAGAAAGATGATAATCTCGAGATTATCATCTTTCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005165
VALIDATED
ALDOC MISSION shRNA Lentiviral Transduction Particles
aldolase C, fructose-bisphosphate
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005165.2-1403s21c1
Sequence:CCGGGACCATAGGATGGGAGGATAGCTCGAGCTATCCTCCCATCCTATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-197s21c1
Sequence:CCGGGACATTGCCCTGCGGATTGTACTCGAGTACAATCCGCAGGGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-360s21c1
Sequence:CCGGAGTGCATTGGAGGCGTCATTTCTCGAGAAATGACGCCTCCAATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005165.2-541s21c1
Sequence:CCGGAGAACGCTGTGCCCAATACAACTCGAGTTGTATTGGGCACAGCGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-610s1c1
Sequence:CCGGCTATTGTGGAACCTGAAATATCTCGAGATATTTCAGGTTCCACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_005165.1-1113s1c1
Sequence:CCGGGCAGCACAGTCACTCTACATTCTCGAGAATGTAGAGTGACTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-647s1c1
Sequence:CCGGCGACCTCAAACGTTGTCAGTACTCGAGTACTGACAACGTTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005165.1-880s1c1
Sequence:CCGGAGAGCGAAGAAGAGGCATCATCTCGAGATGATGCCTCTTCTTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005165.1-306s1c1
Sequence:CCGGCTCTACCAGAAAGATGATAATCTCGAGATTATCATCTTTCTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009657
VALIDATED
ALDOC MISSION shRNA Bacterial Glycerol Stock
aldolase C, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-925s21c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-385s21c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009657.3-1326s21c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-610s21c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009657.2-1327s1c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-517s1c1
Sequence:CCGGCGTAGGCATCAAGGTTGACAACTCGAGTTGTCAACCTTGATGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009657.2-611s1c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-386s1c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-926s1c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009657
VALIDATED
ALDOC MISSION shRNA shRNA Plasmid DNA
aldolase C, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-925s21c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-385s21c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009657.3-1326s21c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-610s21c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009657.2-1327s1c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-517s1c1
Sequence:CCGGCGTAGGCATCAAGGTTGACAACTCGAGTTGTCAACCTTGATGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009657.2-611s1c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-386s1c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-926s1c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009657
VALIDATED
ALDOC MISSION shRNA Lentiviral Transduction Particles
aldolase C, fructose-bisphosphate
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-925s21c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-385s21c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009657.3-1326s21c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009657.3-610s21c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009657.2-1327s1c1
Sequence:CCGGCCTAGCAATGCACATCCCATTCTCGAGAATGGGATGTGCATTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-517s1c1
Sequence:CCGGCGTAGGCATCAAGGTTGACAACTCGAGTTGTCAACCTTGATGCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009657.2-611s1c1
Sequence:CCGGGCTCAGTATAAGAAGGACGGTCTCGAGACCGTCCTTCTTATACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-386s1c1
Sequence:CCGGCAGGTCCTATTCAGTGCTGATCTCGAGATCAGCACTGAATAGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009657.2-926s1c1
Sequence:CCGGCCCATCAAGTATAGCCCAGAACTCGAGTTCTGGGCTATACTTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks