EMAIL THIS PAGE TO A FRIEND

ALG10

ALG10, alpha-1,2-glucosyltransferase

35 Gene Product Result for
Synonyms: ALG10A DIE2 KCR1
UniProtKB ID: Q5BKT4, Q6NS98, Q96DU0, Q96SM6
Gene ID:
Human(84920) Summary: This gene encodes a membrane-associated protein that adds the third glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation. That is, it transfers the terminal glucose from dolichyl phosphate glucose (Dol-P-Glc) onto the lipid-linked oligosaccharide Glc2Man9GlcNAc(2)-PP-Dol. The rat protein homolog was shown to specifically modulate the gating function of the rat neuronal ether-a-go-go (EAG) potassium ion channel. [provided by RefSeq, Jan 2010]
Rat(245960) ALG10, alpha-1,2-glucosyltransferase
sheep(101104224) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
domestic guinea pig(100727296) ALG10, alpha-1,2-glucosyltransferase
naked mole-rat(101710247) ALG10, alpha-1,2-glucosyltransferase
fruit fly(326193) Alpha 3 glucosyltransferase
dog(477647) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
cow(539837) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
Horse(100064952) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
domestic cat(101092445) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
chicken(426734) asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032834 Rosetta Predictions human pricing
NM_139101 Rosetta Predictions rat pricing
XM_346809 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133123 predicted 1743
2 SASI_Hs01_00133120 predicted 1625
3 SASI_Hs01_00133121 predicted 1622
4 SASI_Hs01_00133122 predicted 1612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078829 predicted 1495
2 SASI_Rn02_00268475 predicted 1338
3 SASI_Rn01_00078830 predicted 410
4 SASI_Rn01_00078831 predicted 1391
5 SASI_Rn01_00078832 predicted 1225
6 SASI_Rn01_00078833 predicted 1358
7 SASI_Rn01_00078834 predicted 266
8 SASI_Rn01_00078835 predicted 495
9 SASI_Rn01_00078837 predicted 422
10 SASI_Rn01_00078838 predicted 824
11 SASI_Rn01_00078836 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194111 predicted 1498
2 SASI_Rn01_00194112 predicted 420
3 SASI_Rn01_00194113 predicted 1404
4 SASI_Rn01_00194114 predicted 1232
5 SASI_Rn01_00194115 predicted 1369
6 SASI_Rn01_00194116 predicted 277
7 SASI_Rn01_00194117 predicted 496
8 SASI_Rn01_00194118 predicted 1550
9 SASI_Rn01_00194119 predicted 432
10 SASI_Rn01_00194120 predicted 827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032834
VALIDATED
ALG10 MISSION shRNA Bacterial Glycerol Stock
ALG10, alpha-1,2-glucosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-1072s21c1
Sequence:CCGGGCTTCTGACTTGGCCCTACATCTCGAGATGTAGGGCCAAGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-805s21c1
Sequence:CCGGTGCGTATTTGATGTGTCTTTACTCGAGTAAAGACACATCAAATACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-1979s21c1
Sequence:CCGGTATCTCATATCACTCTCATAACTCGAGTTATGAGAGTGATATGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-2239s21c1
Sequence:CCGGGTTGCTTAACATTTCAGTAATCTCGAGATTACTGAAATGTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-531s21c1
Sequence:CCGGTGTCAATTGGAGTGATCAAACCTCGAGGTTTGATCACTCCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-980s1c1
Sequence:CCGGCCACCTATTAAAGGACCATTTCTCGAGAAATGGTCCTTTAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1555s1c1
Sequence:CCGGGCTGGAATTTCGTTACTTCATCTCGAGATGAAGTAACGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-908s1c1
Sequence:CCGGGCAGGAAATGTCATTGCACAACTCGAGTTGTGCAATGACATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1702s1c1
Sequence:CCGGGTGGCCAAATAGTCAGGACATCTCGAGATGTCCTGACTATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-1269s1c1
Sequence:CCGGCCTTAGTTTGGAAACGTAGAACTCGAGTTCTACGTTTCCAAACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032834
VALIDATED
ALG10 MISSION shRNA shRNA Plasmid DNA
ALG10, alpha-1,2-glucosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-1072s21c1
Sequence:CCGGGCTTCTGACTTGGCCCTACATCTCGAGATGTAGGGCCAAGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-805s21c1
Sequence:CCGGTGCGTATTTGATGTGTCTTTACTCGAGTAAAGACACATCAAATACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-1979s21c1
Sequence:CCGGTATCTCATATCACTCTCATAACTCGAGTTATGAGAGTGATATGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-2239s21c1
Sequence:CCGGGTTGCTTAACATTTCAGTAATCTCGAGATTACTGAAATGTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-531s21c1
Sequence:CCGGTGTCAATTGGAGTGATCAAACCTCGAGGTTTGATCACTCCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-980s1c1
Sequence:CCGGCCACCTATTAAAGGACCATTTCTCGAGAAATGGTCCTTTAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1555s1c1
Sequence:CCGGGCTGGAATTTCGTTACTTCATCTCGAGATGAAGTAACGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-908s1c1
Sequence:CCGGGCAGGAAATGTCATTGCACAACTCGAGTTGTGCAATGACATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1702s1c1
Sequence:CCGGGTGGCCAAATAGTCAGGACATCTCGAGATGTCCTGACTATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-1269s1c1
Sequence:CCGGCCTTAGTTTGGAAACGTAGAACTCGAGTTCTACGTTTCCAAACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032834
VALIDATED
ALG10 MISSION shRNA Lentiviral Transduction Particles
ALG10, alpha-1,2-glucosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-1072s21c1
Sequence:CCGGGCTTCTGACTTGGCCCTACATCTCGAGATGTAGGGCCAAGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-805s21c1
Sequence:CCGGTGCGTATTTGATGTGTCTTTACTCGAGTAAAGACACATCAAATACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-1979s21c1
Sequence:CCGGTATCTCATATCACTCTCATAACTCGAGTTATGAGAGTGATATGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032834.3-2239s21c1
Sequence:CCGGGTTGCTTAACATTTCAGTAATCTCGAGATTACTGAAATGTTAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032834.3-531s21c1
Sequence:CCGGTGTCAATTGGAGTGATCAAACCTCGAGGTTTGATCACTCCAATTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-980s1c1
Sequence:CCGGCCACCTATTAAAGGACCATTTCTCGAGAAATGGTCCTTTAATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1555s1c1
Sequence:CCGGGCTGGAATTTCGTTACTTCATCTCGAGATGAAGTAACGAAATTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-908s1c1
Sequence:CCGGGCAGGAAATGTCATTGCACAACTCGAGTTGTGCAATGACATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032834.2-1702s1c1
Sequence:CCGGGTGGCCAAATAGTCAGGACATCTCGAGATGTCCTGACTATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032834.2-1269s1c1
Sequence:CCGGCCTTAGTTTGGAAACGTAGAACTCGAGTTCTACGTTTCCAAACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks