EMAIL THIS PAGE TO A FRIEND

ALG10B

ALG10B, alpha-1,2-glucosyltransferase

30 Gene Product Result for
Synonyms: ALG10 KCR1
UniProtKB ID: Q5I7T1, B2RPF4
Gene ID:
Mouse(380959) asparagine-linked glycosylation 10B (alpha-1,2-glucosyltransferase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302168 ANTI-ALG10B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_047770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_047770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_047770 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_354869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013620 Rosetta Predictions human pricing
NM_001033441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144568 predicted 1447
2 SASI_Hs01_00144570 predicted 1222
3 SASI_Hs01_00144569 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085821 predicted 1213
2 SASI_Mm01_00085822 predicted 1513
3 SASI_Mm01_00085823 predicted 1425
4 SASI_Mm01_00085824 predicted 1272
5 SASI_Mm01_00085825 predicted 299
6 SASI_Mm01_00085826 predicted 660
7 SASI_Mm01_00085828 predicted 1531
8 SASI_Mm01_00085829 predicted 1176
9 SASI_Mm01_00085830 predicted 1354
10 SASI_Mm02_00288762 predicted 1145
11 SASI_Mm01_00085827 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_047770
VALIDATED
ALG10B MISSION shRNA Bacterial Glycerol Stock
ALG10B, alpha-1,2-glucosyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-493s1c1
Sequence:CCGGGATCCCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-539s1c1
Sequence:CCGGGAGTGGTCAAACCTGCCATTTCTCGAGAAATGGCAGGTTTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-603s1c1
Sequence:CCGGGCTCAGATTTGTTAATCTTCTCTCGAGAGAAGATTAACAAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047770.7-501s1c1
Sequence:CCGGGATTACTACATTACCTGGCTTCTCGAGAAGCCAGGTAATGTAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-349s1c1
Sequence:CCGGGCCGCCTTGAGCTGTACCTTTCTCGAGAAAGGTACAGCTCAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_047770
VALIDATED
ALG10B MISSION shRNA shRNA Plasmid DNA
ALG10B, alpha-1,2-glucosyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-493s1c1
Sequence:CCGGGATCCCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-539s1c1
Sequence:CCGGGAGTGGTCAAACCTGCCATTTCTCGAGAAATGGCAGGTTTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-603s1c1
Sequence:CCGGGCTCAGATTTGTTAATCTTCTCTCGAGAGAAGATTAACAAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047770.7-501s1c1
Sequence:CCGGGATTACTACATTACCTGGCTTCTCGAGAAGCCAGGTAATGTAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-349s1c1
Sequence:CCGGGCCGCCTTGAGCTGTACCTTTCTCGAGAAAGGTACAGCTCAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_047770
VALIDATED
ALG10B MISSION shRNA Lentiviral Transduction Particles
ALG10B, alpha-1,2-glucosyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-493s1c1
Sequence:CCGGGATCCCATGATTACTACATTACTCGAGTAATGTAGTAATCATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-539s1c1
Sequence:CCGGGAGTGGTCAAACCTGCCATTTCTCGAGAAATGGCAGGTTTGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-603s1c1
Sequence:CCGGGCTCAGATTTGTTAATCTTCTCTCGAGAGAAGATTAACAAATCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_047770.7-501s1c1
Sequence:CCGGGATTACTACATTACCTGGCTTCTCGAGAAGCCAGGTAATGTAGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:XM_047770.7-349s1c1
Sequence:CCGGGCCGCCTTGAGCTGTACCTTTCTCGAGAAAGGTACAGCTCAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354869
VALIDATED
ALG10B MISSION shRNA Bacterial Glycerol Stock
ALG10B, alpha-1,2-glucosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1373s1c1
Sequence:CCGGCCGTTACTTCATTCTACCATACTCGAGTATGGTAGAATGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-854s1c1
Sequence:CCGGGTCCCTAAAGAACCTGAGAATCTCGAGATTCTCAGGTTCTTTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-408s1c1
Sequence:CCGGGTGCTCAGATTTGTCAATCTTCTCGAGAAGATTGACAAATCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1113s1c1
Sequence:CCGGGTTACGTTAGTCTCGATACTTCTCGAGAAGTATCGAGACTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-510s1c1
Sequence:CCGGCAGAGAATCTTGTCAACATTACTCGAGTAATGTTGACAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354869
VALIDATED
ALG10B MISSION shRNA shRNA Plasmid DNA
ALG10B, alpha-1,2-glucosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1373s1c1
Sequence:CCGGCCGTTACTTCATTCTACCATACTCGAGTATGGTAGAATGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-854s1c1
Sequence:CCGGGTCCCTAAAGAACCTGAGAATCTCGAGATTCTCAGGTTCTTTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-408s1c1
Sequence:CCGGGTGCTCAGATTTGTCAATCTTCTCGAGAAGATTGACAAATCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1113s1c1
Sequence:CCGGGTTACGTTAGTCTCGATACTTCTCGAGAAGTATCGAGACTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-510s1c1
Sequence:CCGGCAGAGAATCTTGTCAACATTACTCGAGTAATGTTGACAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354869
VALIDATED
ALG10B MISSION shRNA Lentiviral Transduction Particles
ALG10B, alpha-1,2-glucosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1373s1c1
Sequence:CCGGCCGTTACTTCATTCTACCATACTCGAGTATGGTAGAATGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-854s1c1
Sequence:CCGGGTCCCTAAAGAACCTGAGAATCTCGAGATTCTCAGGTTCTTTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-408s1c1
Sequence:CCGGGTGCTCAGATTTGTCAATCTTCTCGAGAAGATTGACAAATCTGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-1113s1c1
Sequence:CCGGGTTACGTTAGTCTCGATACTTCTCGAGAAGTATCGAGACTAACGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_354869.1-510s1c1
Sequence:CCGGCAGAGAATCTTGTCAACATTACTCGAGTAATGTTGACAAGATTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks