EMAIL THIS PAGE TO A FRIEND

ALG11

ALG11, alpha-1,2-mannosyltransferase

154 Gene Product Result for
Synonyms: CDG1P GT8
UniProtKB ID: Q2TAA5, A5PLP3, B4DKW9, Q5TAN9, Q6DKI6, Q96FI7
Gene ID:
Human(440138) Summary: This gene encodes a GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase which is localized to the cytosolic side of the endoplasmic reticulum (ER) and catalyzes the transfer of the fourth and fifth mannose residue from GDP-mannose (GDP-Man) to Man3GlcNAc2-PP-dolichol and Man4GlcNAc2-PP-dolichol resulting in the production of Man5GlcNAc2-PP-dolichol. Mutations in this gene are associated with congenital disorder of glycosylation type Ip (CDGIP). This gene overlaps but is distinct from the UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) gene. A pseudogene of the GDP-Man:Man3GlcNAc2-PP-dolichol-alpha1,2-mannosyltransferase has been identified on chromosome 19. [provided by RefSeq, Aug 2010]
Mouse(207958) asparagine-linked glycosylation 11 (alpha-1,2-mannosyltransferase)
Rat(361174) ALG11, alpha-1,2-mannosyltransferase
naked mole-rat(101712342) ALG11, alpha-1,2-mannosyltransferase
domestic guinea pig(100731328) ALG11, alpha-1,2-mannosyltransferase
sheep(101120844) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
Domestic Rabbit(100340094) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
Zebrafish(407614) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
dog(100682632) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
chicken(418880) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
Horse(100049892) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
cow(540845) ALG11, alpha-1,2-mannosyltransferase
domestic cat(101091245) asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44463 Anti-ALG11 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, canine, human, rat, bovine, rabbit, guinea pig, horse
immunohistochemistry, western blot pricing
SAB2100104 Anti-ALG11 antibody produced in rabbit affinity isolated antibody human, rabbit, rat, bovine, mouse, guinea pig, horse, canine
western blot pricing
HPA047214 Anti-ALG11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU155271 MISSION® esiRNA esiRNA targeting mouse Alg11 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004127 Rosetta Predictions human pricing
NM_001108401 Rosetta Predictions rat pricing
NM_183142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032059 predicted 1655
2 SASI_Hs01_00032060 predicted 1644
3 SASI_Hs01_00032061 predicted 1561
4 SASI_Hs01_00032062 predicted 1512
5 SASI_Hs01_00032063 predicted 1525
6 SASI_Hs01_00032064 predicted 1516
7 SASI_Hs01_00032065 predicted 1701
8 SASI_Hs01_00032066 predicted 1639
9 SASI_Hs01_00032067 predicted 1656
10 SASI_Hs01_00032068 predicted 1637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238299 predicted 1042
2 SASI_Rn02_00238300 predicted 707
3 SASI_Rn02_00238301 predicted 952
4 SASI_Rn02_00238302 predicted 1219
5 SASI_Rn02_00238303 predicted 757
6 SASI_Rn02_00238304 predicted 770
7 SASI_Rn02_00238305 predicted 1051
8 SASI_Rn02_00238306 predicted 812
9 SASI_Rn02_00238307 predicted 827
10 SASI_Rn02_00238308 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350164 predicted 330
2 SASI_Mm01_00111383 predicted 911
3 SASI_Mm01_00111385 predicted 871
4 SASI_Mm01_00111386 predicted 394
5 SASI_Mm01_00111387 predicted 843
6 SASI_Mm01_00111388 predicted 553
7 SASI_Mm01_00111389 predicted 627
8 SASI_Mm01_00111390 predicted 429
9 SASI_Mm01_00111391 predicted 925
10 SASI_Mm01_00111392 predicted 1269
11 SASI_Mm01_00111384 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004127
ALG11 MISSION shRNA Bacterial Glycerol Stock
ALG11, alpha-1,2-mannosyltransferase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1855s1c1
Sequence:CCGGGATGGAAAGAATAGGCGGAAACTCGAGTTTCCGCCTATTCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-300s1c1
Sequence:CCGGGTTGTTTATACCGGCGATGTTCTCGAGAACATCGCCGGTATAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1658s1c1
Sequence:CCGGGCTTCCATTCTTGGTATACATCTCGAGATGTATACCAAGAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1837s1c1
Sequence:CCGGGAAGCAATCATTTCCCTTGATCTCGAGATCAAGGGAAATGATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-315s1c1
Sequence:CCGGGATGTTAATGTCAACGGTCAACTCGAGTTGACCGTTGACATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004127
ALG11 MISSION shRNA shRNA Plasmid DNA
ALG11, alpha-1,2-mannosyltransferase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1855s1c1
Sequence:CCGGGATGGAAAGAATAGGCGGAAACTCGAGTTTCCGCCTATTCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-300s1c1
Sequence:CCGGGTTGTTTATACCGGCGATGTTCTCGAGAACATCGCCGGTATAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1658s1c1
Sequence:CCGGGCTTCCATTCTTGGTATACATCTCGAGATGTATACCAAGAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1837s1c1
Sequence:CCGGGAAGCAATCATTTCCCTTGATCTCGAGATCAAGGGAAATGATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-315s1c1
Sequence:CCGGGATGTTAATGTCAACGGTCAACTCGAGTTGACCGTTGACATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004127
ALG11 MISSION shRNA Lentiviral Transduction Particles
ALG11, alpha-1,2-mannosyltransferase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1855s1c1
Sequence:CCGGGATGGAAAGAATAGGCGGAAACTCGAGTTTCCGCCTATTCTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-300s1c1
Sequence:CCGGGTTGTTTATACCGGCGATGTTCTCGAGAACATCGCCGGTATAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147476    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1658s1c1
Sequence:CCGGGCTTCCATTCTTGGTATACATCTCGAGATGTATACCAAGAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147394    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004127.1-1837s1c1
Sequence:CCGGGAAGCAATCATTTCCCTTGATCTCGAGATCAAGGGAAATGATTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004127.1-315s1c1
Sequence:CCGGGATGTTAATGTCAACGGTCAACTCGAGTTGACCGTTGACATTAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183142
VALIDATED
ALG11 MISSION shRNA Bacterial Glycerol Stock
ALG11, alpha-1,2-mannosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1218s1c1
Sequence:CCGGGCTGACTCTATGGCTCACATTCTCGAGAATGTGAGCCATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1310s1c1
Sequence:CCGGCCAGGAGTTTGAAGTAGCATTCTCGAGAATGCTACTTCAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-633s1c1
Sequence:CCGGAGTGACATAGTCATGGTTAATCTCGAGATTAACCATGACTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183142.1-723s1c1
Sequence:CCGGCCTTGTGATGTGCAGACATTTCTCGAGAAATGTCTGCACATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-631s1c1
Sequence:CCGGGCAGTGACATAGTCATGGTTACTCGAGTAACCATGACTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183142
VALIDATED
ALG11 MISSION shRNA shRNA Plasmid DNA
ALG11, alpha-1,2-mannosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1218s1c1
Sequence:CCGGGCTGACTCTATGGCTCACATTCTCGAGAATGTGAGCCATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1310s1c1
Sequence:CCGGCCAGGAGTTTGAAGTAGCATTCTCGAGAATGCTACTTCAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-633s1c1
Sequence:CCGGAGTGACATAGTCATGGTTAATCTCGAGATTAACCATGACTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183142.1-723s1c1
Sequence:CCGGCCTTGTGATGTGCAGACATTTCTCGAGAAATGTCTGCACATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-631s1c1
Sequence:CCGGGCAGTGACATAGTCATGGTTACTCGAGTAACCATGACTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183142
VALIDATED
ALG11 MISSION shRNA Lentiviral Transduction Particles
ALG11, alpha-1,2-mannosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1218s1c1
Sequence:CCGGGCTGACTCTATGGCTCACATTCTCGAGAATGTGAGCCATAGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-1310s1c1
Sequence:CCGGCCAGGAGTTTGAAGTAGCATTCTCGAGAATGCTACTTCAAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-633s1c1
Sequence:CCGGAGTGACATAGTCATGGTTAATCTCGAGATTAACCATGACTATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183142.1-723s1c1
Sequence:CCGGCCTTGTGATGTGCAGACATTTCTCGAGAAATGTCTGCACATCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183142.1-631s1c1
Sequence:CCGGGCAGTGACATAGTCATGGTTACTCGAGTAACCATGACTATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks