EMAIL THIS PAGE TO A FRIEND

ALG12

ALG12, alpha-1,6-mannosyltransferase

Synonyms: CDG1G ECM39 PP14673 hALG12
UniProtKB ID: Q9BV10, A6PWM1, Q4KMH4, Q8NG10, Q96AA4
Gene ID:
Human(79087) Summary: This gene encodes a member of the glycosyltransferase 22 family. The encoded protein catalyzes the addition of the eighth mannose residue in an alpha-1,6 linkage onto the dolichol-PP-oligosaccharide precursor (dolichol-PP-Man(7)GlcNAc(2)) required for protein glycosylation. Mutations in this gene have been associated with congenital disorder of glycosylation type Ig (CDG-Ig)characterized by abnormal N-glycosylation. [provided by RefSeq, Jul 2008]
Mouse(223774) asparagine-linked glycosylation 12 (alpha-1,6-mannosyltransferase)
Rat(315212) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase
Zebrafish(569494) asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)
cow(100125314) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
domestic cat(101099567) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
dog(481196) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
Thale Cress(5007658) Dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase
chicken(417733) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
sheep(101112896) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
Domestic Rabbit(100346344) asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)
domestic guinea pig(100722302) ALG12, alpha-1,6-mannosyltransferase
naked mole-rat(101715432) ALG12, alpha-1,6-mannosyltransferase
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024105 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024105 Rosetta Predictions human pricing
NM_001108104 Rosetta Predictions rat pricing
NM_145477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161295 predicted 1186
2 SASI_Hs01_00161296 predicted 865
3 SASI_Hs01_00161297 predicted 2018
4 SASI_Hs01_00161298 predicted 804
5 SASI_Hs01_00161300 predicted 926
6 SASI_Hs01_00161302 predicted 984
7 SASI_Hs01_00161303 predicted 1467
8 SASI_Hs01_00161304 predicted 1375
9 SASI_Hs02_00356588 predicted 940
10 SASI_Hs02_00356589 predicted 1251
11 SASI_Hs01_00161299 predicted 1819
12 SASI_Hs01_00161301 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235394 predicted 436
2 SASI_Rn02_00235395 predicted 1122
3 SASI_Rn02_00235396 predicted 1163
4 SASI_Rn02_00235397 predicted 388
5 SASI_Rn02_00235398 predicted 741
6 SASI_Rn02_00235399 predicted 221
7 SASI_Rn02_00235400 predicted 1095
8 SASI_Rn02_00235401 predicted 467
9 SASI_Rn02_00235402 predicted 1129
10 SASI_Rn02_00235403 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120470 predicted 962
2 SASI_Mm01_00120471 predicted 834
3 SASI_Mm01_00120472 predicted 296
4 SASI_Mm01_00120473 predicted 1164
5 SASI_Mm01_00120474 predicted 1119
6 SASI_Mm01_00120475 predicted 482
7 SASI_Mm01_00120476 predicted 767
8 SASI_Mm01_00120477 predicted 227
9 SASI_Mm01_00120478 predicted 471
10 SASI_Mm01_00120479 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024105
ALG12 MISSION shRNA Bacterial Glycerol Stock
ALG12, alpha-1,6-mannosyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-897s1c1
Sequence:CCGGCGGTTGCTGTGGACTCTTATTCTCGAGAATAAGAGTCCACAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1312s1c1
Sequence:CCGGCCTGTATGTGTCCCATTTCAACTCGAGTTGAAATGGGACACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1000s1c1
Sequence:CCGGCCCGCTGCTGTGGTACTTCTACTCGAGTAGAAGTACCACAGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-514s1c1
Sequence:CCGGGCTAATAGTTAGAGGAGTGCTCTCGAGAGCACTCCTCTAACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-485s1c1
Sequence:CCGGCTGTTAGAAATGTCCAAGTTTCTCGAGAAACTTGGACATTTCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024105.3-1161s21c1
Sequence:CCGGTGGGCTTCATGGCACTCTACTCTCGAGAGTAGAGTGCCATGAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-1783s21c1
Sequence:CCGGGCTGTTATCACTACCAGTTTCCTCGAGGAAACTGGTAGTGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-2031s21c1
Sequence:CCGGGGTGCCATTCATGACTAATCACTCGAGTGATTAGTCATGAATGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024105
ALG12 MISSION shRNA shRNA Plasmid DNA
ALG12, alpha-1,6-mannosyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-897s1c1
Sequence:CCGGCGGTTGCTGTGGACTCTTATTCTCGAGAATAAGAGTCCACAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1312s1c1
Sequence:CCGGCCTGTATGTGTCCCATTTCAACTCGAGTTGAAATGGGACACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1000s1c1
Sequence:CCGGCCCGCTGCTGTGGTACTTCTACTCGAGTAGAAGTACCACAGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-514s1c1
Sequence:CCGGGCTAATAGTTAGAGGAGTGCTCTCGAGAGCACTCCTCTAACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-485s1c1
Sequence:CCGGCTGTTAGAAATGTCCAAGTTTCTCGAGAAACTTGGACATTTCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024105.3-1161s21c1
Sequence:CCGGTGGGCTTCATGGCACTCTACTCTCGAGAGTAGAGTGCCATGAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-1783s21c1
Sequence:CCGGGCTGTTATCACTACCAGTTTCCTCGAGGAAACTGGTAGTGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-2031s21c1
Sequence:CCGGGGTGCCATTCATGACTAATCACTCGAGTGATTAGTCATGAATGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024105
ALG12 MISSION shRNA Lentiviral Transduction Particles
ALG12, alpha-1,6-mannosyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-897s1c1
Sequence:CCGGCGGTTGCTGTGGACTCTTATTCTCGAGAATAAGAGTCCACAGCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1312s1c1
Sequence:CCGGCCTGTATGTGTCCCATTTCAACTCGAGTTGAAATGGGACACATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-1000s1c1
Sequence:CCGGCCCGCTGCTGTGGTACTTCTACTCGAGTAGAAGTACCACAGCAGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-514s1c1
Sequence:CCGGGCTAATAGTTAGAGGAGTGCTCTCGAGAGCACTCCTCTAACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024105.2-485s1c1
Sequence:CCGGCTGTTAGAAATGTCCAAGTTTCTCGAGAAACTTGGACATTTCTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024105.3-1161s21c1
Sequence:CCGGTGGGCTTCATGGCACTCTACTCTCGAGAGTAGAGTGCCATGAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-1783s21c1
Sequence:CCGGGCTGTTATCACTACCAGTTTCCTCGAGGAAACTGGTAGTGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024105.3-2031s21c1
Sequence:CCGGGGTGCCATTCATGACTAATCACTCGAGTGATTAGTCATGAATGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145477
VALIDATED
ALG12 MISSION shRNA Bacterial Glycerol Stock
ALG12, alpha-1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145477.1-1607s1c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-904s1c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-796s1c1
Sequence:CCGGACAGGGCATATCTTGGTGAATCTCGAGATTCACCAAGATATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145477.1-129s1c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-439s1c1
Sequence:CCGGGCTGTCATGTTCTGCTGGATACTCGAGTATCCAGCAGAACATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-1136s21c1
Sequence:CCGGTTGAGGGCACTACAGGTATAACTCGAGTTATACCTGTAGTGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-931s21c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-156s21c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145477.2-1634s21c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-248s21c1
Sequence:CCGGAGTACGACCACCACGAGTTTCCTCGAGGAAACTCGTGGTGGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145477
VALIDATED
ALG12 MISSION shRNA shRNA Plasmid DNA
ALG12, alpha-1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145477.1-1607s1c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-904s1c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-796s1c1
Sequence:CCGGACAGGGCATATCTTGGTGAATCTCGAGATTCACCAAGATATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145477.1-129s1c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-439s1c1
Sequence:CCGGGCTGTCATGTTCTGCTGGATACTCGAGTATCCAGCAGAACATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-1136s21c1
Sequence:CCGGTTGAGGGCACTACAGGTATAACTCGAGTTATACCTGTAGTGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-931s21c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-156s21c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145477.2-1634s21c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-248s21c1
Sequence:CCGGAGTACGACCACCACGAGTTTCCTCGAGGAAACTCGTGGTGGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145477
VALIDATED
ALG12 MISSION shRNA Lentiviral Transduction Particles
ALG12, alpha-1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145477.1-1607s1c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-904s1c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-796s1c1
Sequence:CCGGACAGGGCATATCTTGGTGAATCTCGAGATTCACCAAGATATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145477.1-129s1c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145477.1-439s1c1
Sequence:CCGGGCTGTCATGTTCTGCTGGATACTCGAGTATCCAGCAGAACATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-1136s21c1
Sequence:CCGGTTGAGGGCACTACAGGTATAACTCGAGTTATACCTGTAGTGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-931s21c1
Sequence:CCGGCCTCAGACAGATGTCCTTCTTCTCGAGAAGAAGGACATCTGTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-156s21c1
Sequence:CCGGCCACCTGGTTATATGTCCCTACTCGAGTAGGGACATATAACCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145477.2-1634s21c1
Sequence:CCGGCCACGATATAAACCAGGTCTTCTCGAGAAGACCTGGTTTATATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145477.2-248s21c1
Sequence:CCGGAGTACGACCACCACGAGTTTCCTCGAGGAAACTCGTGGTGGTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks