EMAIL THIS PAGE TO A FRIEND

ALG13

ALG13, UDP-N-acetylglucosaminyltransferase subunit

84 Gene Product Result for
Synonyms: CDG1S CXorf45 GLT28D1 MDS031 TDRD13 YGL047W
Gene ID:
Human(79868) Summary: The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(67574) asparagine-linked glycosylation 13
Rat(300284) asparagine-linked glycosylation 13
naked mole-rat(101710153) ALG13, UDP-N-acetylglucosaminyltransferase subunit
domestic guinea pig(100719771) ALG13, UDP-N-acetylglucosaminyltransferase subunit
Zebrafish(557181) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
cow(515282) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
Horse(100058763) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
chicken(422338) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
domestic cat(101095959) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
dog(481021) asparagine-linked glycosylation 13 homolog (S. cerevisiae)
chicken(422339) ALG13, UDP-N-acetylglucosaminyltransferase subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018466 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024810 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040651 MISSION® esiRNA esiRNA human CXorf45 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039210 Rosetta Predictions human pricing
NM_018466 Rosetta Predictions human pricing
NM_001013951 Rosetta Predictions rat pricing
NM_026247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040987 predicted 1309
2 SASI_Hs01_00040988 predicted 1481
3 SASI_Hs01_00040989 predicted 1189
4 SASI_Hs01_00040990 predicted 876
5 SASI_Hs01_00040991 predicted 643
6 SASI_Hs01_00040992 predicted 1317
7 SASI_Hs01_00040993 predicted 207
8 SASI_Hs01_00040994 predicted 537
9 SASI_Hs01_00040995 predicted 1031
10 SASI_Hs01_00040996 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065664 predicted 316
2 SASI_Hs01_00065665 predicted 195
3 SASI_Hs01_00065666 predicted 320
4 SASI_Hs01_00065667 predicted 848
5 SASI_Hs01_00065668 predicted 239
6 SASI_Hs01_00065669 predicted 252
7 SASI_Hs01_00065670 predicted 339
8 SASI_Hs01_00065671 predicted 280
9 SASI_Hs01_00065672 predicted 848
10 SASI_Hs01_00065673 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103360 predicted 338
2 SASI_Rn01_00103361 predicted 398
3 SASI_Rn01_00103363 predicted 286
4 SASI_Rn01_00103364 predicted 479
5 SASI_Rn01_00103365 predicted 231
6 SASI_Rn02_00201265 predicted 257
7 SASI_Rn01_00103366 predicted 226
8 SASI_Rn01_00103367 predicted 654
9 SASI_Rn01_00103368 predicted 407
10 SASI_Rn02_00201266 predicted 573
11 SASI_Rn01_00103362 predicted 367
12 SASI_Rn01_00103369 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042085 predicted 596
2 SASI_Mm01_00042086 predicted 238
3 SASI_Mm01_00042087 predicted 231
4 SASI_Mm01_00042088 predicted 203
5 SASI_Mm01_00042089 predicted 640
6 SASI_Mm02_00329931 predicted 545
7 SASI_Mm01_00042090 predicted 203
8 SASI_Mm01_00042091 predicted 652
9 SASI_Mm01_00042092 predicted 549
10 SASI_Mm01_00042093 predicted 236
11 SASI_Mm01_00042094 predicted 610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018466
ALG13 MISSION shRNA Bacterial Glycerol Stock
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-196s21c1
Sequence:CCGGGTCGTTTACTCTGGATGTTTACTCGAGTAAACATCCAGAGTAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018466.3-1074s21c1
Sequence:CCGGACAGAGTGGAGTGGATATATTCTCGAGAATATATCCACTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-432s21c1
Sequence:CCGGTGTTACAGTCAATGGACTTATCTCGAGATAAGTCCATTGACTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-315s21c1
Sequence:CCGGAGCCACTCGTAGTGGTTATAACTCGAGTTATAACCACTACGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-128s21c1
Sequence:CCGGCTTGGTTACAACCGACTTATCCTCGAGGATAAGTCGGTTGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-127s1c1
Sequence:CCGGCCTTGGTTACAACCGACTTATCTCGAGATAAGTCGGTTGTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-430s1c1
Sequence:CCGGGCTGTTACAGTCAATGGACTTCTCGAGAAGTCCATTGACTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-65s1c1
Sequence:CCGGACCAGCTTTGACGACCTCATTCTCGAGAATGAGGTCGTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-316s1c1
Sequence:CCGGGCCACTCGTAGTGGTTATAAACTCGAGTTTATAACCACTACGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-182s1c1
Sequence:CCGGCCCTTCAGTACTGAGTCGTTTCTCGAGAAACGACTCAGTACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018466
ALG13 MISSION shRNA shRNA Plasmid DNA
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-196s21c1
Sequence:CCGGGTCGTTTACTCTGGATGTTTACTCGAGTAAACATCCAGAGTAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018466.3-1074s21c1
Sequence:CCGGACAGAGTGGAGTGGATATATTCTCGAGAATATATCCACTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-432s21c1
Sequence:CCGGTGTTACAGTCAATGGACTTATCTCGAGATAAGTCCATTGACTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-315s21c1
Sequence:CCGGAGCCACTCGTAGTGGTTATAACTCGAGTTATAACCACTACGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-128s21c1
Sequence:CCGGCTTGGTTACAACCGACTTATCCTCGAGGATAAGTCGGTTGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-127s1c1
Sequence:CCGGCCTTGGTTACAACCGACTTATCTCGAGATAAGTCGGTTGTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-430s1c1
Sequence:CCGGGCTGTTACAGTCAATGGACTTCTCGAGAAGTCCATTGACTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-65s1c1
Sequence:CCGGACCAGCTTTGACGACCTCATTCTCGAGAATGAGGTCGTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-316s1c1
Sequence:CCGGGCCACTCGTAGTGGTTATAAACTCGAGTTTATAACCACTACGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-182s1c1
Sequence:CCGGCCCTTCAGTACTGAGTCGTTTCTCGAGAAACGACTCAGTACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018466
ALG13 MISSION shRNA Lentiviral Transduction Particles
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-196s21c1
Sequence:CCGGGTCGTTTACTCTGGATGTTTACTCGAGTAAACATCCAGAGTAAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018466.3-1074s21c1
Sequence:CCGGACAGAGTGGAGTGGATATATTCTCGAGAATATATCCACTCCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-432s21c1
Sequence:CCGGTGTTACAGTCAATGGACTTATCTCGAGATAAGTCCATTGACTGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-315s21c1
Sequence:CCGGAGCCACTCGTAGTGGTTATAACTCGAGTTATAACCACTACGAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018466.3-128s21c1
Sequence:CCGGCTTGGTTACAACCGACTTATCCTCGAGGATAAGTCGGTTGTAACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-127s1c1
Sequence:CCGGCCTTGGTTACAACCGACTTATCTCGAGATAAGTCGGTTGTAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-430s1c1
Sequence:CCGGGCTGTTACAGTCAATGGACTTCTCGAGAAGTCCATTGACTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-65s1c1
Sequence:CCGGACCAGCTTTGACGACCTCATTCTCGAGAATGAGGTCGTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-316s1c1
Sequence:CCGGGCCACTCGTAGTGGTTATAAACTCGAGTTTATAACCACTACGAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018466.2-182s1c1
Sequence:CCGGCCCTTCAGTACTGAGTCGTTTCTCGAGAAACGACTCAGTACTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026247
ALG13 MISSION shRNA Bacterial Glycerol Stock
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-182s1c1
Sequence:CCGGGTCATTCACTCTGGATGTTTACTCGAGTAAACATCCAGAGTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-416s1c1
Sequence:CCGGGCTGTTACAGTCAATGGATTTCTCGAGAAATCCATTGACTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-228s1c1
Sequence:CCGGGACCTTCAGCAAGCTGATCTTCTCGAGAAGATCAGCTTGCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-213s1c1
Sequence:CCGGGATTCTTTGAAAGAAGACCTTCTCGAGAAGGTCTTCTTTCAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026247.1-871s1c1
Sequence:CCGGCCAGAGAAACTCTGTCTTTAACTCGAGTTAAAGACAGAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026247
ALG13 MISSION shRNA shRNA Plasmid DNA
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-182s1c1
Sequence:CCGGGTCATTCACTCTGGATGTTTACTCGAGTAAACATCCAGAGTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-416s1c1
Sequence:CCGGGCTGTTACAGTCAATGGATTTCTCGAGAAATCCATTGACTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-228s1c1
Sequence:CCGGGACCTTCAGCAAGCTGATCTTCTCGAGAAGATCAGCTTGCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-213s1c1
Sequence:CCGGGATTCTTTGAAAGAAGACCTTCTCGAGAAGGTCTTCTTTCAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026247.1-871s1c1
Sequence:CCGGCCAGAGAAACTCTGTCTTTAACTCGAGTTAAAGACAGAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026247
ALG13 MISSION shRNA Lentiviral Transduction Particles
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-182s1c1
Sequence:CCGGGTCATTCACTCTGGATGTTTACTCGAGTAAACATCCAGAGTGAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-416s1c1
Sequence:CCGGGCTGTTACAGTCAATGGATTTCTCGAGAAATCCATTGACTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-228s1c1
Sequence:CCGGGACCTTCAGCAAGCTGATCTTCTCGAGAAGATCAGCTTGCTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026247.1-213s1c1
Sequence:CCGGGATTCTTTGAAAGAAGACCTTCTCGAGAAGGTCTTCTTTCAAAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026247.1-871s1c1
Sequence:CCGGCCAGAGAAACTCTGTCTTTAACTCGAGTTAAAGACAGAGTTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024810
ALG13 MISSION shRNA Bacterial Glycerol Stock
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024810.1-1681s1c1
Sequence:CCGGGCTTTATATTAGCTGATGGTACTCGAGTACCATCAGCTAATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1195s1c1
Sequence:CCGGCCAGTAATGTCAGATCCCTATCTCGAGATAGGGATCTGACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-963s1c1
Sequence:CCGGGCAGTGCTATTACCACAGCTACTCGAGTAGCTGTGGTAATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-832s1c1
Sequence:CCGGGCAGCGGCTAATCAAGCTATTCTCGAGAATAGCTTGATTAGCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1319s1c1
Sequence:CCGGCTCAAATTCATGGTGCTATAACTCGAGTTATAGCACCATGAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024810
ALG13 MISSION shRNA shRNA Plasmid DNA
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024810.1-1681s1c1
Sequence:CCGGGCTTTATATTAGCTGATGGTACTCGAGTACCATCAGCTAATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1195s1c1
Sequence:CCGGCCAGTAATGTCAGATCCCTATCTCGAGATAGGGATCTGACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-963s1c1
Sequence:CCGGGCAGTGCTATTACCACAGCTACTCGAGTAGCTGTGGTAATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-832s1c1
Sequence:CCGGGCAGCGGCTAATCAAGCTATTCTCGAGAATAGCTTGATTAGCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1319s1c1
Sequence:CCGGCTCAAATTCATGGTGCTATAACTCGAGTTATAGCACCATGAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024810
ALG13 MISSION shRNA Lentiviral Transduction Particles
ALG13, UDP-N-acetylglucosaminyltransferase subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024810.1-1681s1c1
Sequence:CCGGGCTTTATATTAGCTGATGGTACTCGAGTACCATCAGCTAATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1195s1c1
Sequence:CCGGCCAGTAATGTCAGATCCCTATCTCGAGATAGGGATCTGACATTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-963s1c1
Sequence:CCGGGCAGTGCTATTACCACAGCTACTCGAGTAGCTGTGGTAATAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-832s1c1
Sequence:CCGGGCAGCGGCTAATCAAGCTATTCTCGAGAATAGCTTGATTAGCCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024810.1-1319s1c1
Sequence:CCGGCTCAAATTCATGGTGCTATAACTCGAGTTATAGCACCATGAATTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks