EMAIL THIS PAGE TO A FRIEND

ALG14

ALG14, UDP-N-acetylglucosaminyltransferase subunit

55 Gene Product Result for
UniProtKB ID: Q96F25, A8K030
Gene ID:
Human(199857) Summary: Asparagine (N)-glycosylation is an essential modification that regulates protein folding and stability. ALG13 and ALG14 (MIM 612866) constitute the UDP-GlcNAc transferase, which catalyzes a key step in endoplasmic reticulum N-linked glycosylation (Averbeck et al., 2007 [PubMed 17686769]
Mouse(66789) asparagine-linked glycosylation 14
Rat(362031) ALG14, UDP-N-acetylglucosaminyltransferase subunit
Zebrafish(450072) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
cow(506537) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
domestic cat(101101491) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
dog(612241) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
chicken(424484) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
domestic guinea pig(100727075) ALG14, UDP-N-acetylglucosaminyltransferase subunit
naked mole-rat(101699062) ALG14, UDP-N-acetylglucosaminyltransferase subunit
sheep(101108526) asparagine-linked glycosylation 14 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144988 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144988 Rosetta Predictions human pricing
NM_001014176 Rosetta Predictions rat pricing
NM_024178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063857 predicted 440
2 SASI_Hs02_00364794 predicted 431
3 SASI_Hs02_00364795 predicted 244
4 SASI_Hs02_00364796 predicted 306
5 SASI_Hs01_00063862 predicted 296
6 SASI_Hs01_00063863 predicted 321
7 SASI_Hs02_00364797 predicted 237
8 SASI_Hs01_00063865 predicted 209
9 SASI_Hs02_00364798 predicted 458
10 SASI_Hs02_00364799 predicted 277
11 SASI_Hs01_00063856 predicted 469
12 SASI_Hs01_00063858 predicted 572
13 SASI_Hs01_00063859 predicted 683
14 SASI_Hs01_00063860 predicted 657
15 SASI_Hs01_00063861 predicted 223
16 SASI_Hs01_00063864 predicted 609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084640 predicted 586
2 SASI_Rn01_00084641 predicted 785
3 SASI_Rn01_00084643 predicted 770
4 SASI_Rn01_00084644 predicted 394
5 SASI_Rn01_00084645 predicted 470
6 SASI_Rn01_00084646 predicted 321
7 SASI_Rn01_00084647 predicted 301
8 SASI_Rn01_00084648 predicted 819
9 SASI_Rn01_00084649 predicted 384
10 SASI_Rn02_00201673 predicted 811
11 SASI_Rn01_00084642 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148310 predicted 450
2 SASI_Mm01_00148311 predicted 438
3 SASI_Mm01_00148312 predicted 416
4 SASI_Mm01_00148313 predicted 460
5 SASI_Mm01_00148314 predicted 439
6 SASI_Mm01_00148315 predicted 208
7 SASI_Mm01_00148316 predicted 332
8 SASI_Mm02_00327497 predicted 600
9 SASI_Mm01_00148317 predicted 579
10 SASI_Mm01_00148318 predicted 326
11 SASI_Mm01_00148319 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144988
VALIDATED
ALG14 MISSION shRNA Bacterial Glycerol Stock
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-842s1c1
Sequence:CCGGGAGGCTTCTCTTATGAAACAACTCGAGTTGTTTCATAAGAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-681s1c1
Sequence:CCGGCAAATGGCAACTGACTTCTTTCTCGAGAAAGAAGTCAGTTGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-776s1c1
Sequence:CCGGCTGACAGTCCTGAGAATTATTCTCGAGAATAATTCTCAGGACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-833s1c1
Sequence:CCGGGAAGAAACTGAGGCTTCTCTTCTCGAGAAGAGAAGCCTCAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144988.3-774s21c1
Sequence:CCGGACCCTACATGTTTCTTGTAAACTCGAGTTTACAAGAAACATGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144988.3-554s21c1
Sequence:CCGGGATCATTGTCTACGTTGAAAGCTCGAGCTTTCAACGTAGACAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144988
VALIDATED
ALG14 MISSION shRNA shRNA Plasmid DNA
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-842s1c1
Sequence:CCGGGAGGCTTCTCTTATGAAACAACTCGAGTTGTTTCATAAGAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-681s1c1
Sequence:CCGGCAAATGGCAACTGACTTCTTTCTCGAGAAAGAAGTCAGTTGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-776s1c1
Sequence:CCGGCTGACAGTCCTGAGAATTATTCTCGAGAATAATTCTCAGGACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-833s1c1
Sequence:CCGGGAAGAAACTGAGGCTTCTCTTCTCGAGAAGAGAAGCCTCAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144988.3-774s21c1
Sequence:CCGGACCCTACATGTTTCTTGTAAACTCGAGTTTACAAGAAACATGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144988.3-554s21c1
Sequence:CCGGGATCATTGTCTACGTTGAAAGCTCGAGCTTTCAACGTAGACAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144988
VALIDATED
ALG14 MISSION shRNA Lentiviral Transduction Particles
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-842s1c1
Sequence:CCGGGAGGCTTCTCTTATGAAACAACTCGAGTTGTTTCATAAGAGAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-681s1c1
Sequence:CCGGCAAATGGCAACTGACTTCTTTCTCGAGAAAGAAGTCAGTTGCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-776s1c1
Sequence:CCGGCTGACAGTCCTGAGAATTATTCTCGAGAATAATTCTCAGGACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179241    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144988.2-833s1c1
Sequence:CCGGGAAGAAACTGAGGCTTCTCTTCTCGAGAAGAGAAGCCTCAGTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144988.3-774s21c1
Sequence:CCGGACCCTACATGTTTCTTGTAAACTCGAGTTTACAAGAAACATGTAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144988.3-554s21c1
Sequence:CCGGGATCATTGTCTACGTTGAAAGCTCGAGCTTTCAACGTAGACAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024178
VALIDATED
ALG14 MISSION shRNA Bacterial Glycerol Stock
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-771s1c1
Sequence:CCGGCCAAGGAAATATCAATGGTAACTCGAGTTACCATTGATATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-445s1c1
Sequence:CCGGGCCAGATTTGGTGCTGTGTAACTCGAGTTACACAGCACCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-304s1c1
Sequence:CCGGGAATGACTCTACTACTGAATACTCGAGTATTCAGTAGTAGAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-511s1c1
Sequence:CCGGTGGGATACTTGGAGTGAAGAACTCGAGTTCTTCACTCCAAGTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-424s1c1
Sequence:CCGGCCCACTGGTTCTCCGAATAAACTCGAGTTTATTCGGAGAACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024178
VALIDATED
ALG14 MISSION shRNA shRNA Plasmid DNA
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-771s1c1
Sequence:CCGGCCAAGGAAATATCAATGGTAACTCGAGTTACCATTGATATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-445s1c1
Sequence:CCGGGCCAGATTTGGTGCTGTGTAACTCGAGTTACACAGCACCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-304s1c1
Sequence:CCGGGAATGACTCTACTACTGAATACTCGAGTATTCAGTAGTAGAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-511s1c1
Sequence:CCGGTGGGATACTTGGAGTGAAGAACTCGAGTTCTTCACTCCAAGTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-424s1c1
Sequence:CCGGCCCACTGGTTCTCCGAATAAACTCGAGTTTATTCGGAGAACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024178
VALIDATED
ALG14 MISSION shRNA Lentiviral Transduction Particles
ALG14, UDP-N-acetylglucosaminyltransferase subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-771s1c1
Sequence:CCGGCCAAGGAAATATCAATGGTAACTCGAGTTACCATTGATATTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-445s1c1
Sequence:CCGGGCCAGATTTGGTGCTGTGTAACTCGAGTTACACAGCACCAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-304s1c1
Sequence:CCGGGAATGACTCTACTACTGAATACTCGAGTATTCAGTAGTAGAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-511s1c1
Sequence:CCGGTGGGATACTTGGAGTGAAGAACTCGAGTTCTTCACTCCAAGTATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024178.1-424s1c1
Sequence:CCGGCCCACTGGTTCTCCGAATAAACTCGAGTTTATTCGGAGAACCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks