EMAIL THIS PAGE TO A FRIEND

ALG1

ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase

48 Gene Product Result for
Synonyms: CDG1K HMAT1 HMT-1 HMT1 MT-1 Mat-1 hMat-1
UniProtKB ID: Q9BT22, Q6UVZ9, Q8N5Y4, Q9P2Y2
Gene ID:
Human(56052) Summary: The enzyme encoded by this gene catalyzes the first mannosylation step in the biosynthesis of lipid-linked oligosaccharides. This gene is mutated in congenital disorder of glycosylation type Ik. [provided by RefSeq, Dec 2008]
Mouse(208211) asparagine-linked glycosylation 1 (beta-1,4-mannosyltransferase)
Rat(360475) ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Zebrafish(334161) asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase)
domestic cat(101091331) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
cow(507210) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
dog(490017) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
chicken(416393) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
naked mole-rat(101706108) ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
domestic guinea pig(100723491) ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
sheep(101104800) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
Domestic Rabbit(100353396) asparagine-linked glycosylation 1, beta-1,4-mannosyltransferase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019109 Rosetta Predictions human pricing
NM_001108264 Rosetta Predictions rat pricing
NM_145362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096614 predicted 396
2 SASI_Hs01_00096615 predicted 1589
3 SASI_Hs01_00096616 predicted 467
4 SASI_Hs01_00096617 predicted 398
5 SASI_Hs01_00096618 predicted 333
6 SASI_Hs01_00096619 predicted 628
7 SASI_Hs01_00096620 predicted 357
8 SASI_Hs01_00096621 predicted 485
9 SASI_Hs01_00096622 predicted 485
10 SASI_Hs01_00096623 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236944 predicted 436
2 SASI_Rn02_00236945 predicted 308
3 SASI_Rn02_00236946 predicted 311
4 SASI_Rn02_00236947 predicted 244
5 SASI_Rn02_00236948 predicted 303
6 SASI_Rn02_00236949 predicted 249
7 SASI_Rn02_00236950 predicted 654
8 SASI_Rn02_00236951 predicted 888
9 SASI_Rn02_00236952 predicted 879
10 SASI_Rn02_00236953 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340631 predicted 1532
2 SASI_Mm01_00157171 predicted 800
3 SASI_Mm01_00157172 predicted 476
4 SASI_Mm02_00340632 predicted 1376
5 SASI_Mm01_00157173 predicted 658
6 SASI_Mm01_00157174 predicted 471
7 SASI_Mm01_00157175 predicted 397
8 SASI_Mm01_00157176 predicted 905
9 SASI_Mm01_00157177 predicted 1363
10 SASI_Mm02_00340633 predicted 676
11 SASI_Mm01_00157178 predicted 1435
12 SASI_Mm01_00157179 predicted 375
13 SASI_Mm01_00157180 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145362
ALG1 MISSION shRNA Bacterial Glycerol Stock
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145362.1-1422s1c1
Sequence:CCGGGACAGCTAGGAAGAGAGTGATCTCGAGATCACTCTCTTCCTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-709s1c1
Sequence:CCGGCGGCCTTCACTGAGAGGGATTCTCGAGAATCCCTCTCAGTGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-584s1c1
Sequence:CCGGCAAGCCAGCATCTTTCTTTAACTCGAGTTAAAGAAAGATGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-873s1c1
Sequence:CCGGCCTTCCCTCGTCTGTGTGATACTCGAGTATCACACAGACGAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-464s1c1
Sequence:CCGGGCTGGCCAAATGGTATGAGAACTCGAGTTCTCATACCATTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145362
ALG1 MISSION shRNA shRNA Plasmid DNA
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145362.1-1422s1c1
Sequence:CCGGGACAGCTAGGAAGAGAGTGATCTCGAGATCACTCTCTTCCTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-709s1c1
Sequence:CCGGCGGCCTTCACTGAGAGGGATTCTCGAGAATCCCTCTCAGTGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-584s1c1
Sequence:CCGGCAAGCCAGCATCTTTCTTTAACTCGAGTTAAAGAAAGATGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-873s1c1
Sequence:CCGGCCTTCCCTCGTCTGTGTGATACTCGAGTATCACACAGACGAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-464s1c1
Sequence:CCGGGCTGGCCAAATGGTATGAGAACTCGAGTTCTCATACCATTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145362
ALG1 MISSION shRNA Lentiviral Transduction Particles
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145362.1-1422s1c1
Sequence:CCGGGACAGCTAGGAAGAGAGTGATCTCGAGATCACTCTCTTCCTAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-709s1c1
Sequence:CCGGCGGCCTTCACTGAGAGGGATTCTCGAGAATCCCTCTCAGTGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-584s1c1
Sequence:CCGGCAAGCCAGCATCTTTCTTTAACTCGAGTTAAAGAAAGATGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-873s1c1
Sequence:CCGGCCTTCCCTCGTCTGTGTGATACTCGAGTATCACACAGACGAGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145362.1-464s1c1
Sequence:CCGGGCTGGCCAAATGGTATGAGAACTCGAGTTCTCATACCATTTGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019109
VALIDATED
ALG1 MISSION shRNA Bacterial Glycerol Stock
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-607s1c1
Sequence:CCGGCCTGTGTGTTACCAATGCTATCTCGAGATAGCATTGGTAACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-259s1c1
Sequence:CCGGGCTCTTGCAGAACAACAGAATCTCGAGATTCTGTTGTTCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-499s1c1
Sequence:CCGGGCACAACTATGGCTACTCCATCTCGAGATGGAGTAGCCATAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-1405s1c1
Sequence:CCGGCCCTTTGGTTATGGACACATACTCGAGTATGTGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-403s1c1
Sequence:CCGGTGCCTATATCTTTCTCCAGAACTCGAGTTCTGGAGAAAGATATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-640s21c1
Sequence:CCGGGAGAAGACCTGGCGGATAACTCTCGAGAGTTATCCGCCAGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1758s21c1
Sequence:CCGGCCTTTCTGCCGTGTTCCTAACCTCGAGGTTAGGAACACGGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-484s21c1
Sequence:CCGGGTGGAAGCAAGCTCGTCATTGCTCGAGCAATGACGAGCTTGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-571s21c1
Sequence:CCGGTGGCCAAGTGGTACGAGAAGTCTCGAGACTTCTCGTACCACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1862s21c1
Sequence:CCGGGAACTGAGTGTGTCCACGTTGCTCGAGCAACGTGGACACACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019109
VALIDATED
ALG1 MISSION shRNA shRNA Plasmid DNA
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-607s1c1
Sequence:CCGGCCTGTGTGTTACCAATGCTATCTCGAGATAGCATTGGTAACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-259s1c1
Sequence:CCGGGCTCTTGCAGAACAACAGAATCTCGAGATTCTGTTGTTCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-499s1c1
Sequence:CCGGGCACAACTATGGCTACTCCATCTCGAGATGGAGTAGCCATAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-1405s1c1
Sequence:CCGGCCCTTTGGTTATGGACACATACTCGAGTATGTGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-403s1c1
Sequence:CCGGTGCCTATATCTTTCTCCAGAACTCGAGTTCTGGAGAAAGATATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-640s21c1
Sequence:CCGGGAGAAGACCTGGCGGATAACTCTCGAGAGTTATCCGCCAGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1758s21c1
Sequence:CCGGCCTTTCTGCCGTGTTCCTAACCTCGAGGTTAGGAACACGGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-484s21c1
Sequence:CCGGGTGGAAGCAAGCTCGTCATTGCTCGAGCAATGACGAGCTTGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-571s21c1
Sequence:CCGGTGGCCAAGTGGTACGAGAAGTCTCGAGACTTCTCGTACCACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1862s21c1
Sequence:CCGGGAACTGAGTGTGTCCACGTTGCTCGAGCAACGTGGACACACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019109
VALIDATED
ALG1 MISSION shRNA Lentiviral Transduction Particles
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-607s1c1
Sequence:CCGGCCTGTGTGTTACCAATGCTATCTCGAGATAGCATTGGTAACACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-259s1c1
Sequence:CCGGGCTCTTGCAGAACAACAGAATCTCGAGATTCTGTTGTTCTGCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-499s1c1
Sequence:CCGGGCACAACTATGGCTACTCCATCTCGAGATGGAGTAGCCATAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019109.3-1405s1c1
Sequence:CCGGCCCTTTGGTTATGGACACATACTCGAGTATGTGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_019109.3-403s1c1
Sequence:CCGGTGCCTATATCTTTCTCCAGAACTCGAGTTCTGGAGAAAGATATAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-640s21c1
Sequence:CCGGGAGAAGACCTGGCGGATAACTCTCGAGAGTTATCCGCCAGGTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1758s21c1
Sequence:CCGGCCTTTCTGCCGTGTTCCTAACCTCGAGGTTAGGAACACGGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-484s21c1
Sequence:CCGGGTGGAAGCAAGCTCGTCATTGCTCGAGCAATGACGAGCTTGCTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019109.4-571s21c1
Sequence:CCGGTGGCCAAGTGGTACGAGAAGTCTCGAGACTTCTCGTACCACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019109.4-1862s21c1
Sequence:CCGGGAACTGAGTGTGTCCACGTTGCTCGAGCAACGTGGACACACTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks