EMAIL THIS PAGE TO A FRIEND

ALG1L2

ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2

21 Gene Product Result for
Species: Human ALG1L2(644974)
UniProtKB ID: C9J202
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136152 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717734 Rosetta Predictions human pricing
XM_001724565 Rosetta Predictions human pricing
XM_001732858 Rosetta Predictions human pricing
XM_930103 Rosetta Predictions human pricing
XM_934341 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419082 predicted 365
2 SASI_Hs02_00419083 predicted 255
3 SASI_Hs02_00419084 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00462471 predicted 266
2 SASI_Hs02_00462472 predicted 142
3 SASI_Hs02_00462473 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001732858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00478475 predicted 618
2 SASI_Hs02_00478476 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255757 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268745 predicted 325
2 SASI_Hs01_00268746 predicted 318
3 SASI_Hs01_00268747 predicted 319
4 SASI_Hs01_00268748 predicted 315
5 SASI_Hs01_00268749 predicted 281
6 SASI_Hs01_00268750 predicted 272
7 SASI_Hs01_00268751 predicted 540
8 SASI_Hs01_00268752 predicted 557
9 SASI_Hs01_00268753 predicted 673
10 SASI_Hs01_00268754 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136152
ALG1L2 MISSION shRNA Bacterial Glycerol Stock
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000282429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-425s21c1
Sequence:CCGGGCACAAGCTGGACAGAGTTTGCTCGAGCAAACTCTGTCCAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-504s21c1
Sequence:CCGGAGGGCCTCTGAGGGAGTATTACTCGAGTAATACTCCCTCAGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-786s21c1
Sequence:CCGGGGCAGCTCAGCTGCAGTATTTCTCGAGAAATACTGCAGCTGAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-710s21c1
Sequence:CCGGCCGTGAACTTCAAGTGTTTACCTCGAGGTAAACACTTGAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136152
ALG1L2 MISSION shRNA shRNA Plasmid DNA
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000282429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-425s21c1
Sequence:CCGGGCACAAGCTGGACAGAGTTTGCTCGAGCAAACTCTGTCCAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-504s21c1
Sequence:CCGGAGGGCCTCTGAGGGAGTATTACTCGAGTAATACTCCCTCAGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-786s21c1
Sequence:CCGGGGCAGCTCAGCTGCAGTATTTCTCGAGAAATACTGCAGCTGAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-710s21c1
Sequence:CCGGCCGTGAACTTCAAGTGTTTACCTCGAGGTAAACACTTGAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136152
ALG1L2 MISSION shRNA Lentiviral Transduction Particles
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000282429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-425s21c1
Sequence:CCGGGCACAAGCTGGACAGAGTTTGCTCGAGCAAACTCTGTCCAGCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-504s21c1
Sequence:CCGGAGGGCCTCTGAGGGAGTATTACTCGAGTAATACTCCCTCAGAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-786s21c1
Sequence:CCGGGGCAGCTCAGCTGCAGTATTTCTCGAGAAATACTGCAGCTGAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136152.1-710s21c1
Sequence:CCGGCCGTGAACTTCAAGTGTTTACCTCGAGGTAAACACTTGAAGTTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks