EMAIL THIS PAGE TO A FRIEND

ALG1L6P

asparagine-linked glycosylation 1-like 6, pseudogene

5 Gene Product Result for
Species: Human ALG1L6P(339879)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49242 Anti-LOC339879 antibody produced in rabbit IgG fraction of antiserum canine, zebrafish, guinea pig, mouse, rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291054 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001133099 Rosetta Predictions human pricing
XM_001719319 Rosetta Predictions human pricing
XM_291054 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390301 predicted 109
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00429589 predicted 111
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288451 predicted 310
2 SASI_Hs01_00288452 predicted 56
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291054
ALG1L6P MISSION shRNA Bacterial Glycerol Stock
asparagine-linked glycosylation 1-like 6, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-545s1c1
Sequence:CCGGGCCGTGAACTTCAAGTGTTTACTCGAGTAAACACTTGAAGTTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-376s1c1
Sequence:CCGGCCAGAAGCATTTCCAGCACATCTCGAGATGTGCTGGAAATGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-366s1c1
Sequence:CCGGGCCTCATCTACCAGAAGCATTCTCGAGAATGCTTCTGGTAGATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-570s1c1
Sequence:CCGGAGCTGGTGAAACATGAAGAAACTCGAGTTTCTTCATGTTTCACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-319s1c1
Sequence:CCGGCGTCTGTGTGATAACAGGCAACTCGAGTTGCCTGTTATCACACAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291054
ALG1L6P MISSION shRNA shRNA Plasmid DNA
asparagine-linked glycosylation 1-like 6, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-545s1c1
Sequence:CCGGGCCGTGAACTTCAAGTGTTTACTCGAGTAAACACTTGAAGTTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-376s1c1
Sequence:CCGGCCAGAAGCATTTCCAGCACATCTCGAGATGTGCTGGAAATGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-366s1c1
Sequence:CCGGGCCTCATCTACCAGAAGCATTCTCGAGAATGCTTCTGGTAGATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-570s1c1
Sequence:CCGGAGCTGGTGAAACATGAAGAAACTCGAGTTTCTTCATGTTTCACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-319s1c1
Sequence:CCGGCGTCTGTGTGATAACAGGCAACTCGAGTTGCCTGTTATCACACAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291054
ALG1L6P MISSION shRNA Lentiviral Transduction Particles
asparagine-linked glycosylation 1-like 6, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-545s1c1
Sequence:CCGGGCCGTGAACTTCAAGTGTTTACTCGAGTAAACACTTGAAGTTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-376s1c1
Sequence:CCGGCCAGAAGCATTTCCAGCACATCTCGAGATGTGCTGGAAATGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-366s1c1
Sequence:CCGGGCCTCATCTACCAGAAGCATTCTCGAGAATGCTTCTGGTAGATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-570s1c1
Sequence:CCGGAGCTGGTGAAACATGAAGAAACTCGAGTTTCTTCATGTTTCACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291054.2-319s1c1
Sequence:CCGGCGTCTGTGTGATAACAGGCAACTCGAGTTGCCTGTTATCACACAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)