EMAIL THIS PAGE TO A FRIEND

ALG1L

ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like

8 Gene Product Result for
Synonyms: ALG1L1
Species: Human ALG1L(200810)
UniProtKB ID: Q6GMV1, D3DNA5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_114301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_114301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_114301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015050 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015050 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097988 predicted 618
2 SASI_Hs01_00097989 predicted 258
3 SASI_Hs01_00097990 predicted 259
4 SASI_Hs01_00097991 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_114301
ALG1L MISSION shRNA Bacterial Glycerol Stock
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-736s1c1
Sequence:CCGGCCCTTTGGTTATGGACATACACTCGAGTGTATGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-653s1c1
Sequence:CCGGGCAGGCAAGCTAAACCAGTTTCTCGAGAAACTGGTTTAGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-413s1c1
Sequence:CCGGCCTTCTCTTGTCTGTGTGATACTCGAGTATCACACAGACAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-371s1c1
Sequence:CCGGTGGACAGAGTTTGAACAACTTCTCGAGAAGTTGTTCAAACTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-424s1c1
Sequence:CCGGCTGTGTGATAACAGGGTCGGTCTCGAGACCGACCCTGTTATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_114301
ALG1L MISSION shRNA shRNA Plasmid DNA
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-736s1c1
Sequence:CCGGCCCTTTGGTTATGGACATACACTCGAGTGTATGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-653s1c1
Sequence:CCGGGCAGGCAAGCTAAACCAGTTTCTCGAGAAACTGGTTTAGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-413s1c1
Sequence:CCGGCCTTCTCTTGTCTGTGTGATACTCGAGTATCACACAGACAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-371s1c1
Sequence:CCGGTGGACAGAGTTTGAACAACTTCTCGAGAAGTTGTTCAAACTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-424s1c1
Sequence:CCGGCTGTGTGATAACAGGGTCGGTCTCGAGACCGACCCTGTTATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_114301
ALG1L MISSION shRNA Lentiviral Transduction Particles
ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-736s1c1
Sequence:CCGGCCCTTTGGTTATGGACATACACTCGAGTGTATGTCCATAACCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-653s1c1
Sequence:CCGGGCAGGCAAGCTAAACCAGTTTCTCGAGAAACTGGTTTAGCTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-413s1c1
Sequence:CCGGCCTTCTCTTGTCTGTGTGATACTCGAGTATCACACAGACAAGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-371s1c1
Sequence:CCGGTGGACAGAGTTTGAACAACTTCTCGAGAAGTTGTTCAAACTCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_114301.5-424s1c1
Sequence:CCGGCTGTGTGATAACAGGGTCGGTCTCGAGACCGACCCTGTTATCACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks