EMAIL THIS PAGE TO A FRIEND

ALG2

ALG2, alpha-1,3/1,6-mannosyltransferase

85 Gene Product Result for
Synonyms: CDGIi NET38 hALPG2
UniProtKB ID: Q9H553, A2A2Y0, Q8NBX2, Q8NC39
Gene ID:
Human(85365) Summary: This gene encodes a member of the glycosyltransferase 1 family. The encoded protein acts as an alpha 1,3 mannosyltransferase, mannosylating Man(2)GlcNAc(2)-dolichol diphosphate and Man(1)GlcNAc(2)-dolichol diphosphate to form Man(3)GlcNAc(2)-dolichol diphosphate. Defects in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ii). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Mouse(56737) asparagine-linked glycosylation 2 (alpha-1,3-mannosyltransferase)
Rat(313231) ALG2, alpha-1,3/1,6-mannosyltransferase
Zebrafish(403068) asparagine-linked glycosylation 2 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase)
cow(538899) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
Horse(100054840) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
domestic cat(101084066) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
dog(474780) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
chicken(420998) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
sheep(101101953) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
Domestic Rabbit(100353637) asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)
naked mole-rat(101717738) ALG2, alpha-1,3/1,6-mannosyltransferase
domestic guinea pig(100715517) ALG2, alpha-1,3/1,6-mannosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033087 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084571 MISSION® esiRNA esiRNA human ALG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033087 Rosetta Predictions human pricing
XM_001055088 Rosetta Predictions rat pricing
XM_232987 Rosetta Predictions rat pricing
NM_019998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181712 predicted 668
2 SASI_Hs01_00181713 predicted 1030
3 SASI_Hs02_00360791 predicted 622
4 SASI_Hs01_00181714 predicted 1167
5 SASI_Hs01_00181716 predicted 1272
6 SASI_Hs01_00181717 predicted 835
7 SASI_Hs01_00181718 predicted 1596
8 SASI_Hs01_00181719 predicted 656
9 SASI_Hs01_00181720 predicted 1031
10 SASI_Hs01_00181721 predicted 866
11 SASI_Hs01_00181715 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278405 predicted 493
2 SASI_Rn02_00278406 predicted 434
3 SASI_Rn02_00278407 predicted 632
4 SASI_Rn02_00278408 predicted 580
5 SASI_Rn02_00278409 predicted 1020
6 SASI_Rn02_00278410 predicted 622
7 SASI_Rn02_00278411 predicted 236
8 SASI_Rn02_00278412 predicted 607
9 SASI_Rn02_00278413 predicted 650
10 SASI_Rn02_00278414 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232987 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387354 predicted 499
2 SASI_Rn02_00387355 predicted 431
3 SASI_Rn02_00387356 predicted 640
4 SASI_Rn02_00387357 predicted 581
5 SASI_Rn02_00387358 predicted 1015
6 SASI_Rn02_00387359 predicted 624
7 SASI_Rn02_00387360 predicted 237
8 SASI_Rn02_00387361 predicted 603
9 SASI_Rn02_00387362 predicted 652
10 SASI_Rn02_00387363 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114633 predicted 910
2 SASI_Mm02_00325342 predicted 1095
3 SASI_Mm01_00114635 predicted 695
4 SASI_Mm01_00114638 predicted 614
5 SASI_Mm02_00325343 predicted 1370
6 SASI_Mm01_00114640 predicted 429
7 SASI_Mm02_00325344 predicted 695
8 SASI_Mm02_00325345 predicted 752
9 SASI_Mm01_00114641 predicted 882
10 SASI_Mm01_00114642 predicted 1417
11 SASI_Mm01_00114634 predicted 1061
12 SASI_Mm01_00114636 predicted 1303
13 SASI_Mm01_00114637 predicted 711
14 SASI_Mm01_00114639 predicted 1339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033087
VALIDATED
ALG2 MISSION shRNA Bacterial Glycerol Stock
ALG2, alpha-1,3/1,6-mannosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1038s1c1
Sequence:CCGGGCCCAGTCATTGCTGTTAATTCTCGAGAATTAACAGCAATGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-407s1c1
Sequence:CCGGCGGCGGAAGAAGATCCTATTTCTCGAGAAATAGGATCTTCTTCCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-969s1c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1240s1c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033087.1-773s1c1
Sequence:CCGGCGTGGAAGATTGACATCCCAACTCGAGTTGGGATGTCAATCTTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-662s21c1
Sequence:CCGGGTCCTCTATCCATCTCTAAATCTCGAGATTTAGAGATGGATAGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-861s21c1
Sequence:CCGGTGATCGTGGCAGGTGGTTATGCTCGAGCATAACCACCTGCCACGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1605s21c1
Sequence:CCGGATTGCTCTTCTGTCTATAAATCTCGAGATTTATAGACAGAAGAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1288s21c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1017s21c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033087
VALIDATED
ALG2 MISSION shRNA shRNA Plasmid DNA
ALG2, alpha-1,3/1,6-mannosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1038s1c1
Sequence:CCGGGCCCAGTCATTGCTGTTAATTCTCGAGAATTAACAGCAATGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-407s1c1
Sequence:CCGGCGGCGGAAGAAGATCCTATTTCTCGAGAAATAGGATCTTCTTCCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-969s1c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1240s1c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033087.1-773s1c1
Sequence:CCGGCGTGGAAGATTGACATCCCAACTCGAGTTGGGATGTCAATCTTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-662s21c1
Sequence:CCGGGTCCTCTATCCATCTCTAAATCTCGAGATTTAGAGATGGATAGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-861s21c1
Sequence:CCGGTGATCGTGGCAGGTGGTTATGCTCGAGCATAACCACCTGCCACGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1605s21c1
Sequence:CCGGATTGCTCTTCTGTCTATAAATCTCGAGATTTATAGACAGAAGAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1288s21c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1017s21c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033087
VALIDATED
ALG2 MISSION shRNA Lentiviral Transduction Particles
ALG2, alpha-1,3/1,6-mannosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1038s1c1
Sequence:CCGGGCCCAGTCATTGCTGTTAATTCTCGAGAATTAACAGCAATGACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-407s1c1
Sequence:CCGGCGGCGGAAGAAGATCCTATTTCTCGAGAAATAGGATCTTCTTCCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-969s1c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_033087.1-1240s1c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033087.1-773s1c1
Sequence:CCGGCGTGGAAGATTGACATCCCAACTCGAGTTGGGATGTCAATCTTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-662s21c1
Sequence:CCGGGTCCTCTATCCATCTCTAAATCTCGAGATTTAGAGATGGATAGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-861s21c1
Sequence:CCGGTGATCGTGGCAGGTGGTTATGCTCGAGCATAACCACCTGCCACGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294079    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1605s21c1
Sequence:CCGGATTGCTCTTCTGTCTATAAATCTCGAGATTTATAGACAGAAGAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1288s21c1
Sequence:CCGGGCTCTACCGATATGTTACCAACTCGAGTTGGTAACATATCGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_033087.3-1017s21c1
Sequence:CCGGCGTGTGTGCTTTACACACCAACTCGAGTTGGTGTGTAAAGCACACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019998
VALIDATED
ALG2 MISSION shRNA Bacterial Glycerol Stock
ALG2, alpha-1,3/1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019998.2-2555s1c1
Sequence:CCGGCCCTTGAAGATCAGAATTAAACTCGAGTTTAATTCTGATCTTCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-1257s1c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-723s1c1
Sequence:CCGGCCTCTCTATCAACCGATACGACTCGAGTCGTATCGGTTGATAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-840s1c1
Sequence:CCGGCGGTGGTTATGACGATAGGATCTCGAGATCCTATCGTCATAACCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-633s1c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-1299s21c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-466s21c1
Sequence:CCGGCGGCGTAAGAGGGTCCTATTTCTCGAGAAATAGGACCCTCTTACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019998.3-1714s21c1
Sequence:CCGGATTTGACTTCAGAGCGTAATGCTCGAGCATTACGCTCTGAAGTCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-675s21c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-614s21c1
Sequence:CCGGAGTACACTGCTTCCGTCTTTACTCGAGTAAAGACGGAAGCAGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019998
VALIDATED
ALG2 MISSION shRNA shRNA Plasmid DNA
ALG2, alpha-1,3/1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019998.2-2555s1c1
Sequence:CCGGCCCTTGAAGATCAGAATTAAACTCGAGTTTAATTCTGATCTTCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-1257s1c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-723s1c1
Sequence:CCGGCCTCTCTATCAACCGATACGACTCGAGTCGTATCGGTTGATAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-840s1c1
Sequence:CCGGCGGTGGTTATGACGATAGGATCTCGAGATCCTATCGTCATAACCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-633s1c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-1299s21c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-466s21c1
Sequence:CCGGCGGCGTAAGAGGGTCCTATTTCTCGAGAAATAGGACCCTCTTACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019998.3-1714s21c1
Sequence:CCGGATTTGACTTCAGAGCGTAATGCTCGAGCATTACGCTCTGAAGTCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-675s21c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-614s21c1
Sequence:CCGGAGTACACTGCTTCCGTCTTTACTCGAGTAAAGACGGAAGCAGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019998
VALIDATED
ALG2 MISSION shRNA Lentiviral Transduction Particles
ALG2, alpha-1,3/1,6-mannosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110465    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019998.2-2555s1c1
Sequence:CCGGCCCTTGAAGATCAGAATTAAACTCGAGTTTAATTCTGATCTTCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-1257s1c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-723s1c1
Sequence:CCGGCCTCTCTATCAACCGATACGACTCGAGTCGTATCGGTTGATAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-840s1c1
Sequence:CCGGCGGTGGTTATGACGATAGGATCTCGAGATCCTATCGTCATAACCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019998.2-633s1c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-1299s21c1
Sequence:CCGGGCTGTACCAGTATGTCACGAACTCGAGTTCGTGACATACTGGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-466s21c1
Sequence:CCGGCGGCGTAAGAGGGTCCTATTTCTCGAGAAATAGGACCCTCTTACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019998.3-1714s21c1
Sequence:CCGGATTTGACTTCAGAGCGTAATGCTCGAGCATTACGCTCTGAAGTCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-675s21c1
Sequence:CCGGGCTCTACCCATCTCTGAATATCTCGAGATATTCAGAGATGGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019998.3-614s21c1
Sequence:CCGGAGTACACTGCTTCCGTCTTTACTCGAGTAAAGACGGAAGCAGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)