EMAIL THIS PAGE TO A FRIEND

ALG3

ALG3, alpha-1,3- mannosyltransferase

57 Gene Product Result for
Synonyms: CDG1D CDGS4 D16Ertd36e NOT56L Not56
UniProtKB ID: Q92685, A8JZZ6, Q9BT71
Gene ID:
Human(10195) Summary: This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(208624) asparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase)
Rat(287983) ALG3, alpha-1,3- mannosyltransferase
domestic guinea pig(100724786) ALG3, alpha-1,3- mannosyltransferase
naked mole-rat(101714764) ALG3, alpha-1,3- mannosyltransferase
sheep(101121650) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
Zebrafish(553725) asparagine-linked glycosylation 3 homolog (S. cerevisiae, alpha-1,3-mannosyltransferase)
chicken(424952) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
domestic cat(101087681) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
cow(614624) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
Horse(100059007) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
dog(478653) asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)
Thale Cress(819388) Dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046091 MISSION® esiRNA esiRNA targeting mouse Alg3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005787 Rosetta Predictions human pricing
NM_001011897 Rosetta Predictions rat pricing
XM_573315 Rosetta Predictions rat pricing
NM_145939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040025 predicted 719
2 SASI_Hs01_00040027 predicted 289
3 SASI_Hs01_00040028 predicted 456
4 SASI_Hs01_00040029 predicted 782
5 SASI_Hs01_00040030 predicted 253
6 SASI_Hs01_00040031 predicted 1083
7 SASI_Hs01_00040032 predicted 217
8 SASI_Hs02_00340281 predicted 324
9 SASI_Hs01_00040034 predicted 1187
10 SASI_Hs02_00340282 predicted 510
11 SASI_Hs01_00040026 predicted 414
12 SASI_Hs01_00040033 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108672 predicted 929
2 SASI_Rn01_00108673 predicted 546
3 SASI_Rn01_00108674 predicted 627
4 SASI_Rn01_00108675 predicted 637
5 SASI_Rn01_00108676 predicted 665
6 SASI_Rn01_00108677 predicted 786
7 SASI_Rn01_00108678 predicted 391
8 SASI_Rn01_00108680 predicted 514
9 SASI_Rn02_00199878 predicted 334
10 SASI_Rn01_00108681 predicted 382
11 SASI_Rn01_00108679 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122724 predicted 915
2 SASI_Rn01_00122725 predicted 538
3 SASI_Rn01_00122726 predicted 615
4 SASI_Rn01_00122727 predicted 621
5 SASI_Rn01_00122728 predicted 648
6 SASI_Rn01_00122729 predicted 769
7 SASI_Rn01_00122730 predicted 376
8 SASI_Rn01_00122731 predicted 1059
9 SASI_Rn01_00122732 predicted 502
10 SASI_Rn01_00122733 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153618 predicted 443
2 SASI_Mm01_00153619 predicted 650
3 SASI_Mm01_00153620 predicted 768
4 SASI_Mm01_00153621 predicted 526
5 SASI_Mm01_00153622 predicted 784
6 SASI_Mm01_00153623 predicted 492
7 SASI_Mm01_00153624 predicted 202
8 SASI_Mm01_00153625 predicted 481
9 SASI_Mm01_00153626 predicted 645
10 SASI_Mm01_00153627 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005787
VALIDATED
ALG3 MISSION shRNA Bacterial Glycerol Stock
ALG3, alpha-1,3- mannosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1102s21c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1039s21c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-637s21c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-439s21c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-335s21c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1014s1c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-414s1c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-310s1c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-612s1c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1077s1c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005787
VALIDATED
ALG3 MISSION shRNA shRNA Plasmid DNA
ALG3, alpha-1,3- mannosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1102s21c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1039s21c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-637s21c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-439s21c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-335s21c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1014s1c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-414s1c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-310s1c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-612s1c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1077s1c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005787
VALIDATED
ALG3 MISSION shRNA Lentiviral Transduction Particles
ALG3, alpha-1,3- mannosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1102s21c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-1039s21c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-637s21c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-439s21c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005787.5-335s21c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1014s1c1
Sequence:CCGGCCAGATCGTTTCTACCCTCTTCTCGAGAAGAGGGTAGAAACGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-414s1c1
Sequence:CCGGGCTGCTTGTCTTCTTGATCTACTCGAGTAGATCAAGAAGACAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-310s1c1
Sequence:CCGGGCTGGTTTCGTGTACATCTTTCTCGAGAAAGATGTACACGAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-612s1c1
Sequence:CCGGCCTGGCAGTCTCTGTGAAGATCTCGAGATCTTCACAGAGACTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005787.3-1077s1c1
Sequence:CCGGCTACCAGTTCTACGTCTGGTACTCGAGTACCAGACGTAGAACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145939
VALIDATED
ALG3 MISSION shRNA Bacterial Glycerol Stock
ALG3, alpha-1,3- mannosyltransferase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-491s21c1
Sequence:CCGGACCGTGTCCATTCCATCTTTGCTCGAGCAAAGATGGAATGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-791s21c1
Sequence:CCGGTTGACCTTGGTCGTCAGTTTCCTCGAGGAAACTGACGACCAAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-522s1c1
Sequence:CCGGCTTCAATGACCCAGTAGCTATCTCGAGATAGCTACTGGGTCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-244s21c1
Sequence:CCGGGGTTTCATCAATGGCACATATCTCGAGATATGTGCCATTGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-1031s21c1
Sequence:CCGGTCTTCACCTCCAACTTCATTGCTCGAGCAATGAAGTTGGAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-1005s21c1
Sequence:CCGGCACACCTAACCAGATTGTTTCCTCGAGGAAACAATCTGGTTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-381s1c1
Sequence:CCGGGAACATCTTTGCTGTACTCTACTCGAGTAGAGTACAGCAAAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145939
VALIDATED
ALG3 MISSION shRNA shRNA Plasmid DNA
ALG3, alpha-1,3- mannosyltransferase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-491s21c1
Sequence:CCGGACCGTGTCCATTCCATCTTTGCTCGAGCAAAGATGGAATGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-791s21c1
Sequence:CCGGTTGACCTTGGTCGTCAGTTTCCTCGAGGAAACTGACGACCAAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-522s1c1
Sequence:CCGGCTTCAATGACCCAGTAGCTATCTCGAGATAGCTACTGGGTCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-244s21c1
Sequence:CCGGGGTTTCATCAATGGCACATATCTCGAGATATGTGCCATTGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-1031s21c1
Sequence:CCGGTCTTCACCTCCAACTTCATTGCTCGAGCAATGAAGTTGGAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-1005s21c1
Sequence:CCGGCACACCTAACCAGATTGTTTCCTCGAGGAAACAATCTGGTTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-381s1c1
Sequence:CCGGGAACATCTTTGCTGTACTCTACTCGAGTAGAGTACAGCAAAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145939
VALIDATED
ALG3 MISSION shRNA Lentiviral Transduction Particles
ALG3, alpha-1,3- mannosyltransferase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-491s21c1
Sequence:CCGGACCGTGTCCATTCCATCTTTGCTCGAGCAAAGATGGAATGGACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-791s21c1
Sequence:CCGGTTGACCTTGGTCGTCAGTTTCCTCGAGGAAACTGACGACCAAGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-522s1c1
Sequence:CCGGCTTCAATGACCCAGTAGCTATCTCGAGATAGCTACTGGGTCATTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-244s21c1
Sequence:CCGGGGTTTCATCAATGGCACATATCTCGAGATATGTGCCATTGATGAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145939.1-1031s21c1
Sequence:CCGGTCTTCACCTCCAACTTCATTGCTCGAGCAATGAAGTTGGAGGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145939.1-1005s21c1
Sequence:CCGGCACACCTAACCAGATTGTTTCCTCGAGGAAACAATCTGGTTAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145939.1-381s1c1
Sequence:CCGGGAACATCTTTGCTGTACTCTACTCGAGTAGAGTACAGCAAAGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks