EMAIL THIS PAGE TO A FRIEND

ALG5

ALG5, dolichyl-phosphate beta-glucosyltransferase

47 Gene Product Result for
Synonyms: RP11-421P11.2 bA421P11.2
UniProtKB ID: Q9Y673, B4DR37, Q5TBA6
Gene ID:
Human(29880) Summary: This gene encodes a member of the glycosyltransferase 2 family. The encoded protein participates in glucosylation of the oligomannose core in N-linked glycosylation of proteins. The addition of glucose residues to the oligomannose core is necessary to ensure substrate recognition, and therefore, effectual transfer of the oligomannose core to the nascent glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(66248) asparagine-linked glycosylation 5 (dolichyl-phosphate beta-glucosyltransferase)
Rat(295051) ALG5, dolichyl-phosphate beta-glucosyltransferase
Zebrafish(751635) asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)
domestic cat(101086366) asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)
dog(477301) asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)
cow(506566) asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)
chicken(418898) asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)
sheep(101108665) asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)
naked mole-rat(101713618) ALG5, dolichyl-phosphate beta-glucosyltransferase
domestic guinea pig(100727154) ALG5, dolichyl-phosphate beta-glucosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013338 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025442 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025442 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025442 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013338 Rosetta Predictions human pricing
NM_001025407 Rosetta Predictions rat pricing
NM_025442 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014203 predicted 437
2 SASI_Hs01_00014204 predicted 339
3 SASI_Hs01_00014205 predicted 418
4 SASI_Hs01_00014206 predicted 470
5 SASI_Hs01_00014207 predicted 894
6 SASI_Hs01_00014208 predicted 641
7 SASI_Hs01_00014209 predicted 681
8 SASI_Hs01_00014210 predicted 226
9 SASI_Hs01_00014211 predicted 438
10 SASI_Hs01_00014212 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025407 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071739 predicted 965
2 SASI_Rn01_00071740 predicted 855
3 SASI_Rn01_00071741 predicted 303
4 SASI_Rn02_00203143 predicted 438
5 SASI_Rn01_00071742 predicted 1077
6 SASI_Rn01_00071743 predicted 858
7 SASI_Rn01_00071744 predicted 1014
8 SASI_Rn01_00071746 predicted 957
9 SASI_Rn02_00203144 predicted 500
10 SASI_Rn01_00071747 predicted 613
11 SASI_Rn01_00071745 predicted 1037
12 SASI_Rn01_00071748 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025442 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102154 predicted 373
2 SASI_Mm01_00102155 predicted 341
3 SASI_Mm01_00102156 predicted 903
4 SASI_Mm01_00102157 predicted 885
5 SASI_Mm01_00102158 predicted 476
6 SASI_Mm01_00102159 predicted 542
7 SASI_Mm02_00328270 predicted 803
8 SASI_Mm01_00102161 predicted 424
9 SASI_Mm01_00102162 predicted 240
10 SASI_Mm01_00102163 predicted 230
11 SASI_Mm01_00102160 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013338
ALG5 MISSION shRNA Bacterial Glycerol Stock
ALG5, dolichyl-phosphate beta-glucosyltransferase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-338s1c1
Sequence:CCGGGCGTTCACTTATGAAGTGATACTCGAGTATCACTTCATAAGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-372s1c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-662s1c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-448s1c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-875s1c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-902s21c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-689s21c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-399s21c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-475s21c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013338
ALG5 MISSION shRNA shRNA Plasmid DNA
ALG5, dolichyl-phosphate beta-glucosyltransferase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-338s1c1
Sequence:CCGGGCGTTCACTTATGAAGTGATACTCGAGTATCACTTCATAAGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-372s1c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-662s1c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-448s1c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-875s1c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-902s21c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-689s21c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-399s21c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-475s21c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013338
ALG5 MISSION shRNA Lentiviral Transduction Particles
ALG5, dolichyl-phosphate beta-glucosyltransferase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-338s1c1
Sequence:CCGGGCGTTCACTTATGAAGTGATACTCGAGTATCACTTCATAAGTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-372s1c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-662s1c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-448s1c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013338.3-875s1c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-902s21c1
Sequence:CCGGGCTGTCAACTGGACAGAAATTCTCGAGAATTTCTGTCCAGTTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-689s21c1
Sequence:CCGGCGTTCTTACTTCCGTACTCTTCTCGAGAAGAGTACGGAAGTAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-399s21c1
Sequence:CCGGGCAGTAAAGATCAGACCTCAACTCGAGTTGAGGTCTGATCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013338.4-475s21c1
Sequence:CCGGCCTGGTGAAGAATCGTGGAAACTCGAGTTTCCACGATTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025442
VALIDATED
ALG5 MISSION shRNA Bacterial Glycerol Stock
ALG5, dolichyl-phosphate beta-glucosyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025442.1-1118s1c1
Sequence:CCGGGCCTTTGTATATTCTTGAGAACTCGAGTTCTCAAGAATATACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-101s1c1
Sequence:CCGGGCGCTCATACTGGTTTCCATTCTCGAGAATGGAAACCAGTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-233s1c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-805s1c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-668s1c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-390s21c1
Sequence:CCGGGACGTCAAAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTTTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-804s21c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-232s21c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-667s21c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025442.3-1182s21c1
Sequence:CCGGTTTGTGCCATAAGTTAGATTTCTCGAGAAATCTAACTTATGGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025442
VALIDATED
ALG5 MISSION shRNA shRNA Plasmid DNA
ALG5, dolichyl-phosphate beta-glucosyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025442.1-1118s1c1
Sequence:CCGGGCCTTTGTATATTCTTGAGAACTCGAGTTCTCAAGAATATACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-101s1c1
Sequence:CCGGGCGCTCATACTGGTTTCCATTCTCGAGAATGGAAACCAGTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-233s1c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-805s1c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-668s1c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-390s21c1
Sequence:CCGGGACGTCAAAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTTTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-804s21c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-232s21c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-667s21c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025442.3-1182s21c1
Sequence:CCGGTTTGTGCCATAAGTTAGATTTCTCGAGAAATCTAACTTATGGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025442
VALIDATED
ALG5 MISSION shRNA Lentiviral Transduction Particles
ALG5, dolichyl-phosphate beta-glucosyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110300    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025442.1-1118s1c1
Sequence:CCGGGCCTTTGTATATTCTTGAGAACTCGAGTTCTCAAGAATATACAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-101s1c1
Sequence:CCGGGCGCTCATACTGGTTTCCATTCTCGAGAATGGAAACCAGTATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-233s1c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-805s1c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025442.1-668s1c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-390s21c1
Sequence:CCGGGACGTCAAAGGTCGCTTTAAACTCGAGTTTAAAGCGACCTTTGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-804s21c1
Sequence:CCGGGCACATTGAACGATGGGCATTCTCGAGAATGCCCATCGTTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-232s21c1
Sequence:CCGGCCTACGAAACAGCTATCTGTTCTCGAGAACAGATAGCTGTTTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025442.3-667s21c1
Sequence:CCGGCGCTCTTACTTCCGTACCTTTCTCGAGAAAGGTACGGAAGTAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025442.3-1182s21c1
Sequence:CCGGTTTGTGCCATAAGTTAGATTTCTCGAGAAATCTAACTTATGGCACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks