EMAIL THIS PAGE TO A FRIEND

ALG6

ALG6, alpha-1,3-glucosyltransferase

114 Gene Product Result for
Synonyms: CDG1C
UniProtKB ID: Q9Y672, B3KMU2, Q5SXR9, Q9H3I0
Gene ID:
Human(29929) Summary: This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the first glucose residue to the growing lipid-linked oligosaccharide precursor of N-linked glycosylation. Mutations in this gene are associated with congenital disorders of glycosylation type Ic. [provided by RefSeq, Jul 2008]
Mouse(320438) asparagine-linked glycosylation 6 (alpha-1,3,-glucosyltransferase)
Rat(362547) ALG6, alpha-1,3-glucosyltransferase
domestic guinea pig(100728854) ALG6, alpha-1,3-glucosyltransferase
naked mole-rat(101713296) ALG6, alpha-1,3-glucosyltransferase
sheep(101108436) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
Zebrafish(445327) asparagine-linked glycosylation 6 homolog (S. cerevisiae, alpha-1,3-glucosyltransferase)
cow(510138) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
Horse(100070118) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
domestic cat(101082423) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
dog(609974) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
chicken(395078) asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032551 MISSION® esiRNA esiRNA human ALG6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013339 Rosetta Predictions human pricing
NM_001033709 Rosetta Predictions rat pricing
NM_001081264 Rosetta Predictions mouse pricing
XM_620085 Rosetta Predictions mouse pricing
XM_901067 Rosetta Predictions mouse pricing
XM_901071 Rosetta Predictions mouse pricing
XM_901073 Rosetta Predictions mouse pricing
XM_901077 Rosetta Predictions mouse pricing
XM_901080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084469 predicted 1542
2 SASI_Hs01_00084470 predicted 1417
3 SASI_Hs01_00084471 predicted 269
4 SASI_Hs01_00084472 predicted 542
5 SASI_Hs01_00084474 predicted 1651
6 SASI_Hs01_00084475 predicted 1606
7 SASI_Hs01_00084476 predicted 510
8 SASI_Hs02_00344651 predicted 512
9 SASI_Hs01_00084477 predicted 589
10 SASI_Hs01_00084478 predicted 486
11 SASI_Hs01_00084473 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084905 predicted 1533
2 SASI_Rn01_00084906 predicted 436
3 SASI_Rn01_00084907 predicted 345
4 SASI_Rn01_00084908 predicted 1805
5 SASI_Rn01_00084909 predicted 1665
6 SASI_Rn01_00084910 predicted 290
7 SASI_Rn01_00084911 predicted 1151
8 SASI_Rn01_00084912 predicted 369
9 SASI_Rn01_00084913 predicted 1068
10 SASI_Rn01_00084914 predicted 1709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296767 predicted 333
2 SASI_Mm02_00296768 predicted 1065
3 SASI_Mm02_00296769 predicted 1394
4 SASI_Mm02_00296770 predicted 1231
5 SASI_Mm02_00296771 predicted 444
6 SASI_Mm02_00296772 predicted 441
7 SASI_Mm02_00296773 predicted 290
8 SASI_Mm02_00296774 predicted 335
9 SASI_Mm02_00296775 predicted 1591
10 SASI_Mm02_00296776 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00275385 predicted 346
2 SASI_Mm01_00275386 predicted 1067
3 SASI_Mm01_00275387 predicted 1402
4 SASI_Mm01_00275388 predicted 1234
5 SASI_Mm01_00275389 predicted 447
6 SASI_Mm01_00275390 predicted 447
7 SASI_Mm01_00275391 predicted 295
8 SASI_Mm01_00275392 predicted 347
9 SASI_Mm01_00275393 predicted 1597
10 SASI_Mm01_00275394 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281868 predicted 205
2 SASI_Mm01_00281869 predicted 348
3 SASI_Mm01_00281870 predicted 290
4 SASI_Mm01_00281871 predicted 222
5 SASI_Mm01_00281872 predicted 297
6 SASI_Mm01_00281873 predicted 291
7 SASI_Mm01_00281874 predicted 364
8 SASI_Mm01_00281875 predicted 337
9 SASI_Mm01_00281876 predicted 214
10 SASI_Mm01_00281877 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214098 predicted 567
2 SASI_Mm01_00214099 predicted 702
3 SASI_Mm01_00214100 predicted 310
4 SASI_Mm01_00214101 predicted 350
5 SASI_Mm01_00214102 predicted 375
6 SASI_Mm01_00214103 predicted 667
7 SASI_Mm01_00214104 predicted 347
8 SASI_Mm01_00214105 predicted 306
9 SASI_Mm01_00214106 predicted 836
10 SASI_Mm01_00214107 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271456 predicted 342
2 SASI_Mm01_00271457 predicted 449
3 SASI_Mm01_00271458 predicted 290
4 SASI_Mm01_00271459 predicted 441
5 SASI_Mm01_00271460 predicted 298
6 SASI_Mm01_00271461 predicted 296
7 SASI_Mm01_00271462 predicted 339
8 SASI_Mm01_00271463 predicted 339
9 SASI_Mm01_00271464 predicted 422
10 SASI_Mm01_00271465 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00211380 predicted 856
2 SASI_Mm01_00211381 predicted 869
3 SASI_Mm01_00211382 predicted 667
4 SASI_Mm01_00211383 predicted 345
5 SASI_Mm01_00211384 predicted 301
6 SASI_Mm01_00211385 predicted 335
7 SASI_Mm01_00211386 predicted 292
8 SASI_Mm01_00211387 predicted 451
9 SASI_Mm01_00211388 predicted 461
10 SASI_Mm01_00211389 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202421 predicted 1087
2 SASI_Mm01_00202422 predicted 561
3 SASI_Mm01_00202423 predicted 899
4 SASI_Mm01_00202424 predicted 302
5 SASI_Mm01_00202425 predicted 354
6 SASI_Mm01_00202426 predicted 376
7 SASI_Mm01_00202427 predicted 345
8 SASI_Mm01_00202428 predicted 683
9 SASI_Mm01_00202429 predicted 648
10 SASI_Mm01_00202430 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013339
ALG6 MISSION shRNA Bacterial Glycerol Stock
ALG6, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1181s21c1
Sequence:CCGGGCCACGTCACATCCAATTAATCTCGAGATTAATTGGATGTGACGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1293s21c1
Sequence:CCGGGTTAGCTGTGCGCTATCATTCCTCGAGGAATGATAGCGCACAGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-984s21c1
Sequence:CCGGGGGTTTGTGTTGCTAGTTAAGCTCGAGCTTAACTAGCAACACAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-458s21c1
Sequence:CCGGACCGGTCAAACAATGGTATTTCTCGAGAAATACCATTGTTTGACCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-594s21c1
Sequence:CCGGCTCCATACATCACGTGGATATCTCGAGATATCCACGTGATGTATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1070s1c1
Sequence:CCGGCGTGGATTATTTGAGGATAAACTCGAGTTTATCCTCAAATAATCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-362s1c1
Sequence:CCGGCCGCCTATGTTTGGTGATTATCTCGAGATAATCACCAAACATAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1227s1c1
Sequence:CCGGCCTCTTCCAAAGGATTCAAATCTCGAGATTTGAATCCTTTGGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-485s1c1
Sequence:CCGGCCACCTCTTACAGCTTATCATCTCGAGATGATAAGCTGTAAGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1403s1c1
Sequence:CCGGCCTCTTCTATTGAAGGATGAACTCGAGTTCATCCTTCAATAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013339
ALG6 MISSION shRNA shRNA Plasmid DNA
ALG6, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1181s21c1
Sequence:CCGGGCCACGTCACATCCAATTAATCTCGAGATTAATTGGATGTGACGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1293s21c1
Sequence:CCGGGTTAGCTGTGCGCTATCATTCCTCGAGGAATGATAGCGCACAGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-984s21c1
Sequence:CCGGGGGTTTGTGTTGCTAGTTAAGCTCGAGCTTAACTAGCAACACAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-458s21c1
Sequence:CCGGACCGGTCAAACAATGGTATTTCTCGAGAAATACCATTGTTTGACCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-594s21c1
Sequence:CCGGCTCCATACATCACGTGGATATCTCGAGATATCCACGTGATGTATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1070s1c1
Sequence:CCGGCGTGGATTATTTGAGGATAAACTCGAGTTTATCCTCAAATAATCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-362s1c1
Sequence:CCGGCCGCCTATGTTTGGTGATTATCTCGAGATAATCACCAAACATAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1227s1c1
Sequence:CCGGCCTCTTCCAAAGGATTCAAATCTCGAGATTTGAATCCTTTGGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-485s1c1
Sequence:CCGGCCACCTCTTACAGCTTATCATCTCGAGATGATAAGCTGTAAGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1403s1c1
Sequence:CCGGCCTCTTCTATTGAAGGATGAACTCGAGTTCATCCTTCAATAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013339
ALG6 MISSION shRNA Lentiviral Transduction Particles
ALG6, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1181s21c1
Sequence:CCGGGCCACGTCACATCCAATTAATCTCGAGATTAATTGGATGTGACGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-1293s21c1
Sequence:CCGGGTTAGCTGTGCGCTATCATTCCTCGAGGAATGATAGCGCACAGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-984s21c1
Sequence:CCGGGGGTTTGTGTTGCTAGTTAAGCTCGAGCTTAACTAGCAACACAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-458s21c1
Sequence:CCGGACCGGTCAAACAATGGTATTTCTCGAGAAATACCATTGTTTGACCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013339.3-594s21c1
Sequence:CCGGCTCCATACATCACGTGGATATCTCGAGATATCCACGTGATGTATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1070s1c1
Sequence:CCGGCGTGGATTATTTGAGGATAAACTCGAGTTTATCCTCAAATAATCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-362s1c1
Sequence:CCGGCCGCCTATGTTTGGTGATTATCTCGAGATAATCACCAAACATAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1227s1c1
Sequence:CCGGCCTCTTCCAAAGGATTCAAATCTCGAGATTTGAATCCTTTGGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-485s1c1
Sequence:CCGGCCACCTCTTACAGCTTATCATCTCGAGATGATAAGCTGTAAGAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013339.2-1403s1c1
Sequence:CCGGCCTCTTCTATTGAAGGATGAACTCGAGTTCATCCTTCAATAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081264
VALIDATED
ALG6 MISSION shRNA Bacterial Glycerol Stock
ALG6, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081264.1-2937s21c1
Sequence:CCGGACCTTGTTAACACCGAAATAACTCGAGTTATTTCGGTGTTAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-650s21c1
Sequence:CCGGTGCTGTATCCAGGTCTTATTCCTCGAGGAATAAGACCTGGATACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-293s21c1
Sequence:CCGGCACCTATGTTTGGTGATTATGCTCGAGCATAATCACCAAACATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-1013s21c1
Sequence:CCGGAGGATAAAGTCGCTAATATTTCTCGAGAAATATTAGCGACTTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-341s21c1
Sequence:CCGGCCCTTAATTTACCAGTCAAACCTCGAGGTTTGACTGGTAAATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081264
VALIDATED
ALG6 MISSION shRNA shRNA Plasmid DNA
ALG6, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081264.1-2937s21c1
Sequence:CCGGACCTTGTTAACACCGAAATAACTCGAGTTATTTCGGTGTTAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-650s21c1
Sequence:CCGGTGCTGTATCCAGGTCTTATTCCTCGAGGAATAAGACCTGGATACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-293s21c1
Sequence:CCGGCACCTATGTTTGGTGATTATGCTCGAGCATAATCACCAAACATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-1013s21c1
Sequence:CCGGAGGATAAAGTCGCTAATATTTCTCGAGAAATATTAGCGACTTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-341s21c1
Sequence:CCGGCCCTTAATTTACCAGTCAAACCTCGAGGTTTGACTGGTAAATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081264
VALIDATED
ALG6 MISSION shRNA Lentiviral Transduction Particles
ALG6, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081264.1-2937s21c1
Sequence:CCGGACCTTGTTAACACCGAAATAACTCGAGTTATTTCGGTGTTAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-650s21c1
Sequence:CCGGTGCTGTATCCAGGTCTTATTCCTCGAGGAATAAGACCTGGATACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-293s21c1
Sequence:CCGGCACCTATGTTTGGTGATTATGCTCGAGCATAATCACCAAACATAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-1013s21c1
Sequence:CCGGAGGATAAAGTCGCTAATATTTCTCGAGAAATATTAGCGACTTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081264.1-341s21c1
Sequence:CCGGCCCTTAATTTACCAGTCAAACCTCGAGGTTTGACTGGTAAATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)