EMAIL THIS PAGE TO A FRIEND

ALG8

ALG8, alpha-1,3-glucosyltransferase

61 Gene Product Result for
Synonyms: CDG1H
UniProtKB ID: Q9BVK2, A6NDW6, O60860
Gene ID:
Human(79053) Summary: This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(381903) asparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
Rat(293129) ALG8, alpha-1,3-glucosyltransferase
Zebrafish(327601) asparagine-linked glycosylation 8 homolog (yeast, alpha-1,3-glucosyltransferase)
chicken(428097) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
dog(476793) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
cow(538731) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
Horse(100051152) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
domestic cat(101080479) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
sheep(101109656) asparagine-linked glycosylation 8, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)
naked mole-rat(101717763) ALG8, alpha-1,3-glucosyltransferase
domestic guinea pig(100732933) ALG8, alpha-1,3-glucosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024079 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048191 MISSION® esiRNA esiRNA targeting mouse Alg8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007027 Rosetta Predictions human pricing
NM_024079 Rosetta Predictions human pricing
NM_001034127 Rosetta Predictions rat pricing
NM_199035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030439 predicted 326
2 SASI_Hs01_00030440 predicted 214
3 SASI_Hs01_00030441 predicted 683
4 SASI_Hs02_00305179 predicted 756
5 SASI_Hs01_00030443 predicted 1093
6 SASI_Hs01_00030444 predicted 738
7 SASI_Hs01_00030445 predicted 220
8 SASI_Hs01_00030446 predicted 671
9 SASI_Hs02_00305180 predicted 295
10 SASI_Hs01_00030447 predicted 273
11 SASI_Hs01_00030442 predicted 626
12 SASI_Hs01_00030448 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049484 predicted 326
2 SASI_Hs01_00049485 predicted 211
3 SASI_Hs01_00049486 predicted 683
4 SASI_Hs02_00356547 predicted 754
5 SASI_Hs01_00049488 predicted 1088
6 SASI_Hs01_00049489 predicted 743
7 SASI_Hs01_00049490 predicted 224
8 SASI_Hs01_00049491 predicted 665
9 SASI_Hs02_00356548 predicted 300
10 SASI_Hs01_00049492 predicted 267
11 SASI_Hs01_00049487 predicted 631
12 SASI_Hs01_00049493 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064319 predicted 296
2 SASI_Rn01_00064320 predicted 1039
3 SASI_Rn01_00064321 predicted 850
4 SASI_Rn02_00203960 predicted 1667
5 SASI_Rn02_00203961 predicted 901
6 SASI_Rn01_00064324 predicted 461
7 SASI_Rn01_00064325 predicted 712
8 SASI_Rn01_00064326 predicted 1600
9 SASI_Rn01_00064327 predicted 754
10 SASI_Rn01_00064328 predicted 1582
11 SASI_Rn01_00064322 predicted 253
12 SASI_Rn01_00064323 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167971 predicted 1046
2 SASI_Mm02_00351315 predicted 263
3 SASI_Mm01_00167974 predicted 472
4 SASI_Mm01_00167975 predicted 359
5 SASI_Mm01_00167976 predicted 282
6 SASI_Mm01_00167978 predicted 1636
7 SASI_Mm01_00167979 predicted 530
8 SASI_Mm01_00167980 predicted 1314
9 SASI_Mm02_00351316 predicted 1679
10 SASI_Mm02_00351317 predicted 1435
11 SASI_Mm01_00167972 predicted 309
12 SASI_Mm01_00167973 predicted 1666
13 SASI_Mm01_00167977 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199035
ALG8 MISSION shRNA Bacterial Glycerol Stock
ALG8, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199035.1-1667s1c1
Sequence:CCGGGCAGGGTCTATTTATTTAGTACTCGAGTACTAAATAAATAGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1278s1c1
Sequence:CCGGCTGCACCAGAACTTCCCATTACTCGAGTAATGGGAAGTTCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1307s1c1
Sequence:CCGGCTCATGTTACTGTTCACGGTTCTCGAGAACCGTGAACAGTAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-240s1c1
Sequence:CCGGCCTTATCACATATTGCCAAATCTCGAGATTTGGCAATATGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-238s1c1
Sequence:CCGGCGCCTTATCACATATTGCCAACTCGAGTTGGCAATATGTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199035
ALG8 MISSION shRNA shRNA Plasmid DNA
ALG8, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199035.1-1667s1c1
Sequence:CCGGGCAGGGTCTATTTATTTAGTACTCGAGTACTAAATAAATAGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1278s1c1
Sequence:CCGGCTGCACCAGAACTTCCCATTACTCGAGTAATGGGAAGTTCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1307s1c1
Sequence:CCGGCTCATGTTACTGTTCACGGTTCTCGAGAACCGTGAACAGTAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-240s1c1
Sequence:CCGGCCTTATCACATATTGCCAAATCTCGAGATTTGGCAATATGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-238s1c1
Sequence:CCGGCGCCTTATCACATATTGCCAACTCGAGTTGGCAATATGTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199035
ALG8 MISSION shRNA Lentiviral Transduction Particles
ALG8, alpha-1,3-glucosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199035.1-1667s1c1
Sequence:CCGGGCAGGGTCTATTTATTTAGTACTCGAGTACTAAATAAATAGACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1278s1c1
Sequence:CCGGCTGCACCAGAACTTCCCATTACTCGAGTAATGGGAAGTTCTGGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-1307s1c1
Sequence:CCGGCTCATGTTACTGTTCACGGTTCTCGAGAACCGTGAACAGTAACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-240s1c1
Sequence:CCGGCCTTATCACATATTGCCAAATCTCGAGATTTGGCAATATGTGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199035.1-238s1c1
Sequence:CCGGCGCCTTATCACATATTGCCAACTCGAGTTGGCAATATGTGATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024079
ALG8 MISSION shRNA Bacterial Glycerol Stock
ALG8, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-177s1c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-341s1c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-794s1c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-567s1c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-1318s1c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-584s21c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-358s21c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-1335s21c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-194s21c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-811s21c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024079
ALG8 MISSION shRNA shRNA Plasmid DNA
ALG8, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-177s1c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-341s1c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-794s1c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-567s1c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-1318s1c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-584s21c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-358s21c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-1335s21c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-194s21c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-811s21c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024079
ALG8 MISSION shRNA Lentiviral Transduction Particles
ALG8, alpha-1,3-glucosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-177s1c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-341s1c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-794s1c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-567s1c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024079.2-1318s1c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-584s21c1
Sequence:CCGGGCTACTCTCCATTGCACGATTCTCGAGAATCGTGCAATGGAGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-358s21c1
Sequence:CCGGCCAGCTCAAGGACCTTACTTTCTCGAGAAAGTAAGGTCCTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-1335s21c1
Sequence:CCGGGCACCAGAACTTCCCATTAAACTCGAGTTTAATGGGAAGTTCTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-194s21c1
Sequence:CCGGGCTTGCTATCACTCACAGTTTCTCGAGAAACTGTGAGTGATAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024079.4-811s21c1
Sequence:CCGGCTGCTCTTTCATTGGGTCCTTCTCGAGAAGGACCCAATGAAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks