EMAIL THIS PAGE TO A FRIEND

ALG9

ALG9, alpha-1,2-mannosyltransferase

174 Gene Product Result for
Synonyms: CDG1L DIBD1 LOH11CR1J
UniProtKB ID: Q9H6U8, Q6ZMD5, Q7Z4R4, Q96GS7, Q96PB9, Q9H068
Gene ID:
Human(79796) Summary: This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(102580) asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Rat(367083) alpha-1,2-mannosyltransferase
domestic guinea pig(100713205) ALG9, alpha-1,2-mannosyltransferase
naked mole-rat(101720220) ALG9, alpha-1,2-mannosyltransferase
sheep(101109477) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
Zebrafish(393598) asparagine-linked glycosylation 9 homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)
chicken(428255) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
dog(609002) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
cow(504346) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
Horse(100070423) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
domestic cat(101092139) asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077690 Rosetta Predictions human pricing
NM_001077691 Rosetta Predictions human pricing
NM_001077692 Rosetta Predictions human pricing
NM_024740 Rosetta Predictions human pricing
NM_001109000 Rosetta Predictions rat pricing
NM_133981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313116 predicted 1694
2 SASI_Hs02_00313117 predicted 1758
3 SASI_Hs02_00313118 predicted 1994
4 SASI_Hs02_00313119 predicted 601
5 SASI_Hs02_00313120 predicted 1542
6 SASI_Hs02_00313121 predicted 1794
7 SASI_Hs02_00313122 predicted 664
8 SASI_Hs02_00313123 predicted 1619
9 SASI_Hs02_00313124 predicted 1488
10 SASI_Hs02_00313125 predicted 1851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313126 predicted 925
2 SASI_Hs02_00313127 predicted 1988
3 SASI_Hs02_00313128 predicted 2057
4 SASI_Hs02_00313129 predicted 2292
5 SASI_Hs02_00313130 predicted 1837
6 SASI_Hs02_00313131 predicted 2085
7 SASI_Hs02_00313132 predicted 942
8 SASI_Hs02_00313133 predicted 1922
9 SASI_Hs02_00313134 predicted 1782
10 SASI_Hs02_00313135 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313136 predicted 926
2 SASI_Hs02_00313137 predicted 1967
3 SASI_Hs02_00313138 predicted 2039
4 SASI_Hs02_00313139 predicted 2279
5 SASI_Hs02_00313140 predicted 1813
6 SASI_Hs02_00313141 predicted 2065
7 SASI_Hs02_00313142 predicted 948
8 SASI_Hs02_00313143 predicted 1902
9 SASI_Hs02_00313144 predicted 1764
10 SASI_Hs02_00313145 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357214 predicted 1715
2 SASI_Hs01_00058912 predicted 1779
3 SASI_Hs02_00357215 predicted 2016
4 SASI_Hs01_00058914 predicted 602
5 SASI_Hs02_00357216 predicted 1564
6 SASI_Hs02_00357217 predicted 1812
7 SASI_Hs01_00058918 predicted 672
8 SASI_Hs02_00357218 predicted 1648
9 SASI_Hs02_00357219 predicted 1506
10 SASI_Hs02_00357220 predicted 1877
11 SASI_Hs01_00058911 predicted 1375
12 SASI_Hs01_00058913 predicted 1123
13 SASI_Hs01_00058915 predicted 1159
14 SASI_Hs01_00058916 predicted 1140
15 SASI_Hs01_00058917 predicted 1330
16 SASI_Hs01_00058919 predicted 266
17 SASI_Hs01_00058920 predicted 1773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244184 predicted 561
2 SASI_Rn02_00244185 predicted 1433
3 SASI_Rn02_00244186 predicted 1229
4 SASI_Rn02_00244187 predicted 1113
5 SASI_Rn02_00244188 predicted 915
6 SASI_Rn02_00244189 predicted 1203
7 SASI_Rn02_00244190 predicted 1138
8 SASI_Rn02_00244191 predicted 1165
9 SASI_Rn02_00244192 predicted 722
10 SASI_Rn02_00244193 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032284 predicted 1498
2 SASI_Mm01_00032285 predicted 721
3 SASI_Mm01_00032286 predicted 1645
4 SASI_Mm01_00032287 predicted 376
5 SASI_Mm01_00032288 predicted 447
6 SASI_Mm01_00032289 predicted 1953
7 SASI_Mm02_00339110 predicted 1816
8 SASI_Mm01_00032290 predicted 1070
9 SASI_Mm01_00032291 predicted 1772
10 SASI_Mm01_00032292 predicted 1693
11 SASI_Mm01_00032283 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133981
VALIDATED
ALG9 MISSION shRNA Bacterial Glycerol Stock
ALG9, alpha-1,2-mannosyltransferase
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-2364s21c1
Sequence:CCGGGCCTAGTTGCCAACCAGATATCTCGAGATATCTGGTTGGCAACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-927s21c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1078s21c1
Sequence:CCGGGAATTTAGGACACCCGTATTGCTCGAGCAATACGGGTGTCCTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-856s21c1
Sequence:CCGGGGTCATTGACAGCTACTATTACTCGAGTAATAGTAGCTGTCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1624s21c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-1958s21c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-661s21c1
Sequence:CCGGCGCCATGACGGGATGGTATATCTCGAGATATACCATCCCGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1958s1c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1109s1c1
Sequence:CCGGGCGCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-927s1c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133981.1-1624s1c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-425s1c1
Sequence:CCGGGCTGCATTTCATGCACGGATTCTCGAGAATCCGTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133981
VALIDATED
ALG9 MISSION shRNA shRNA Plasmid DNA
ALG9, alpha-1,2-mannosyltransferase
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-2364s21c1
Sequence:CCGGGCCTAGTTGCCAACCAGATATCTCGAGATATCTGGTTGGCAACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-927s21c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1078s21c1
Sequence:CCGGGAATTTAGGACACCCGTATTGCTCGAGCAATACGGGTGTCCTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-856s21c1
Sequence:CCGGGGTCATTGACAGCTACTATTACTCGAGTAATAGTAGCTGTCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1624s21c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-1958s21c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-661s21c1
Sequence:CCGGCGCCATGACGGGATGGTATATCTCGAGATATACCATCCCGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1958s1c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1109s1c1
Sequence:CCGGGCGCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-927s1c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133981.1-1624s1c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-425s1c1
Sequence:CCGGGCTGCATTTCATGCACGGATTCTCGAGAATCCGTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133981
VALIDATED
ALG9 MISSION shRNA Lentiviral Transduction Particles
ALG9, alpha-1,2-mannosyltransferase
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-2364s21c1
Sequence:CCGGGCCTAGTTGCCAACCAGATATCTCGAGATATCTGGTTGGCAACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-927s21c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1078s21c1
Sequence:CCGGGAATTTAGGACACCCGTATTGCTCGAGCAATACGGGTGTCCTAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-856s21c1
Sequence:CCGGGGTCATTGACAGCTACTATTACTCGAGTAATAGTAGCTGTCAATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-1624s21c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133981.1-1958s21c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133981.1-661s21c1
Sequence:CCGGCGCCATGACGGGATGGTATATCTCGAGATATACCATCCCGTCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1958s1c1
Sequence:CCGGGCATCCTGTTAGAGCTGTAATCTCGAGATTACAGCTCTAACAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-1109s1c1
Sequence:CCGGGCGCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-927s1c1
Sequence:CCGGCGTCTCATGGACCTGATCTTTCTCGAGAAAGATCAGGTCCATGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133981.1-1624s1c1
Sequence:CCGGGCCTTCCAGATACATTGACATCTCGAGATGTCAATGTATCTGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133981.1-425s1c1
Sequence:CCGGGCTGCATTTCATGCACGGATTCTCGAGAATCCGTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024740
VALIDATED
ALG9 MISSION shRNA Bacterial Glycerol Stock
ALG9, alpha-1,2-mannosyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024740.2-901s21c1
Sequence:CCGGGTCATTGACAGCTACTATTATCTCGAGATAATAGTAGCTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1436s21c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1153s21c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024740.2-2090s21c1
Sequence:CCGGGGGCTAGTCAAAGTCTATTTCCTCGAGGAAATAGACTTTGACTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1217s21c1
Sequence:CCGGTCCCTGTGTATCCACTTATATCTCGAGATATAAGTGGATACACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1153s1c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-367s1c1
Sequence:CCGGCCAACACACTACCTCATCTATCTCGAGATAGATGAGGTAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1436s1c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024740.1-469s1c1
Sequence:CCGGGCTGCATTTCATGCAAGAATTCTCGAGAATTCTTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1924s1c1
Sequence:CCGGGCAAAGCAAATCAGGAAGAAACTCGAGTTTCTTCCTGATTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024740
VALIDATED
ALG9 MISSION shRNA shRNA Plasmid DNA
ALG9, alpha-1,2-mannosyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024740.2-901s21c1
Sequence:CCGGGTCATTGACAGCTACTATTATCTCGAGATAATAGTAGCTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1436s21c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1153s21c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024740.2-2090s21c1
Sequence:CCGGGGGCTAGTCAAAGTCTATTTCCTCGAGGAAATAGACTTTGACTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1217s21c1
Sequence:CCGGTCCCTGTGTATCCACTTATATCTCGAGATATAAGTGGATACACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1153s1c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-367s1c1
Sequence:CCGGCCAACACACTACCTCATCTATCTCGAGATAGATGAGGTAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1436s1c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024740.1-469s1c1
Sequence:CCGGGCTGCATTTCATGCAAGAATTCTCGAGAATTCTTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1924s1c1
Sequence:CCGGGCAAAGCAAATCAGGAAGAAACTCGAGTTTCTTCCTGATTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024740
VALIDATED
ALG9 MISSION shRNA Lentiviral Transduction Particles
ALG9, alpha-1,2-mannosyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024740.2-901s21c1
Sequence:CCGGGTCATTGACAGCTACTATTATCTCGAGATAATAGTAGCTGTCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1436s21c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1153s21c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024740.2-2090s21c1
Sequence:CCGGGGGCTAGTCAAAGTCTATTTCCTCGAGGAAATAGACTTTGACTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_024740.2-1217s21c1
Sequence:CCGGTCCCTGTGTATCCACTTATATCTCGAGATATAAGTGGATACACAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1153s1c1
Sequence:CCGGGCTCCAATGTATATTTGGTTTCTCGAGAAACCAAATATACATTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-367s1c1
Sequence:CCGGCCAACACACTACCTCATCTATCTCGAGATAGATGAGGTAGTGTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1436s1c1
Sequence:CCGGCCCTTGATTTGTATCCAGAATCTCGAGATTCTGGATACAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024740.1-469s1c1
Sequence:CCGGGCTGCATTTCATGCAAGAATTCTCGAGAATTCTTGCATGAAATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_024740.1-1924s1c1
Sequence:CCGGGCAAAGCAAATCAGGAAGAAACTCGAGTTTCTTCCTGATTTGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks