EMAIL THIS PAGE TO A FRIEND

ALK

anaplastic lymphoma receptor tyrosine kinase

67 Gene Product Result for
Synonyms: CD246 NBLST3
UniProtKB ID: Q9UM73, Q4ZFX9, Q53QQ6, Q53RZ4, Q59FI3, Q9Y4K6
Gene ID:
Human(238) Summary: This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
Mouse(11682) anaplastic lymphoma kinase
Rat(266802) anaplastic lymphoma receptor tyrosine kinase
Zebrafish(563509) anaplastic lymphoma kinase (Ki-1)
chicken(421297) anaplastic lymphoma receptor tyrosine kinase
dog(483021) anaplastic lymphoma receptor tyrosine kinase
Horse(100070891) anaplastic lymphoma receptor tyrosine kinase
domestic cat(101091689) anaplastic lymphoma receptor tyrosine kinase
fruit fly(53425) CG8250 gene product from transcript CG8250-RB
naked mole-rat(101703312) anaplastic lymphoma receptor tyrosine kinase
domestic guinea pig(100732585) anaplastic lymphoma receptor tyrosine kinase
sheep(101114094) anaplastic lymphoma receptor tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A5357 Anti-ALK (1601-1615) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A5232 Anti-ALK (186-200) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4301583 Anti-ALK (Phospho-TYR1604) affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2501695 Anti-Alk antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
HPA010694 Anti-ALK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5500003 Anti-ALK/P80 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP8, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB5500005 Anti-Anaplastic Lymphoma Kinase antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP144, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4504604 Anti-phospho-ALK (pTyr1096) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4301288 Anti-phospho-ALK (pTyr1096) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4504018 Anti-phospho-ALK (pTyr1507) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301463 Anti-phospho-ALK (pTyr1507) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504019 Anti-phospho-ALK (pTyr1604) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0934 Phosphotyrosine ALK / ALK Tyrosine Kinase Receptor ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004304 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004304 Rosetta Predictions human pricing
XM_001067235 Rosetta Predictions rat pricing
XM_233867 Rosetta Predictions rat pricing
NM_007439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056329 predicted 5710
2 SASI_Hs01_00056330 predicted 3833
3 SASI_Hs01_00056331 predicted 2457
4 SASI_Hs01_00056332 predicted 2840
5 SASI_Hs01_00056334 predicted 1571
6 SASI_Hs01_00056335 predicted 3490
7 SASI_Hs02_00337326 predicted 3726
8 SASI_Hs01_00056336 predicted 2943
9 SASI_Hs01_00056337 predicted 5387
10 SASI_Hs01_00056338 predicted 2562
11 SASI_Hs01_00056333 predicted 2326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320332 predicted 4675
2 SASI_Rn02_00320333 predicted 4322
3 SASI_Rn02_00320334 predicted 4990
4 SASI_Rn02_00320335 predicted 2875
5 SASI_Rn02_00320336 predicted 3110
6 SASI_Rn02_00320337 predicted 5046
7 SASI_Rn02_00320338 predicted 2861
8 SASI_Rn02_00320339 predicted 4366
9 SASI_Rn02_00320340 predicted 2136
10 SASI_Rn02_00320341 predicted 2672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144396 predicted 4665
2 SASI_Rn01_00144397 predicted 1263
3 SASI_Rn01_00144398 predicted 5721
4 SASI_Rn01_00144399 predicted 3013
5 SASI_Rn01_00144400 predicted 6943
6 SASI_Rn01_00144401 predicted 9911
7 SASI_Rn01_00144402 predicted 2190
8 SASI_Rn01_00144403 predicted 4707
9 SASI_Rn01_00144404 predicted 1615
10 SASI_Rn01_00144405 predicted 4679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107086 predicted 2536
2 SASI_Mm01_00107087 predicted 4036
3 SASI_Mm01_00107088 predicted 1301
4 SASI_Mm02_00311599 predicted 2626
5 SASI_Mm01_00107089 predicted 1628
6 SASI_Mm01_00107091 predicted 4047
7 SASI_Mm01_00107092 predicted 2760
8 SASI_Mm02_00311600 predicted 5354
9 SASI_Mm01_00107093 predicted 1050
10 SASI_Mm01_00107094 predicted 2557
11 SASI_Mm01_00107090 predicted 2334
12 SASI_Mm01_00107095 predicted 2648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007439
ALK MISSION shRNA Bacterial Glycerol Stock
anaplastic lymphoma receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4246s1c1
Sequence:CCGGGCTGGAAGAATAGCAAAGATTCTCGAGAATCTTTGCTATTCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-3264s1c1
Sequence:CCGGCGGAGGATATATAGGTGGCAACTCGAGTTGCCACCTATATATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-5205s1c1
Sequence:CCGGCCCGAACGTCAACTATGGTTACTCGAGTAACCATAGTTGACGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4203s1c1
Sequence:CCGGCCGGGATATTGCTGCTAGAAACTCGAGTTTCTAGCAGCAATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4360s1c1
Sequence:CCGGGCCTTCATGGAAGGGATATTTCTCGAGAAATATCCCTTCCATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4326s21c1
Sequence:CCGGACCTAGAGGAGAATCACTTTACTCGAGTAAAGTGATTCTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-3075s21c1
Sequence:CCGGGTGGAGCCACCTACGTGTTTACTCGAGTAAACACGTAGGTGGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4675s21c1
Sequence:CCGGCGGGCCTGTATACCGGATAATCTCGAGATTATCCGGTATACAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007439
ALK MISSION shRNA shRNA Plasmid DNA
anaplastic lymphoma receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4246s1c1
Sequence:CCGGGCTGGAAGAATAGCAAAGATTCTCGAGAATCTTTGCTATTCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-3264s1c1
Sequence:CCGGCGGAGGATATATAGGTGGCAACTCGAGTTGCCACCTATATATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-5205s1c1
Sequence:CCGGCCCGAACGTCAACTATGGTTACTCGAGTAACCATAGTTGACGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4203s1c1
Sequence:CCGGCCGGGATATTGCTGCTAGAAACTCGAGTTTCTAGCAGCAATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4360s1c1
Sequence:CCGGGCCTTCATGGAAGGGATATTTCTCGAGAAATATCCCTTCCATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4326s21c1
Sequence:CCGGACCTAGAGGAGAATCACTTTACTCGAGTAAAGTGATTCTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-3075s21c1
Sequence:CCGGGTGGAGCCACCTACGTGTTTACTCGAGTAAACACGTAGGTGGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4675s21c1
Sequence:CCGGCGGGCCTGTATACCGGATAATCTCGAGATTATCCGGTATACAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007439
ALK MISSION shRNA Lentiviral Transduction Particles
anaplastic lymphoma receptor tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4246s1c1
Sequence:CCGGGCTGGAAGAATAGCAAAGATTCTCGAGAATCTTTGCTATTCTTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-3264s1c1
Sequence:CCGGCGGAGGATATATAGGTGGCAACTCGAGTTGCCACCTATATATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-5205s1c1
Sequence:CCGGCCCGAACGTCAACTATGGTTACTCGAGTAACCATAGTTGACGTTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4203s1c1
Sequence:CCGGCCGGGATATTGCTGCTAGAAACTCGAGTTTCTAGCAGCAATATCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007439.1-4360s1c1
Sequence:CCGGGCCTTCATGGAAGGGATATTTCTCGAGAAATATCCCTTCCATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4326s21c1
Sequence:CCGGACCTAGAGGAGAATCACTTTACTCGAGTAAAGTGATTCTCCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-3075s21c1
Sequence:CCGGGTGGAGCCACCTACGTGTTTACTCGAGTAAACACGTAGGTGGCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007439.2-4675s21c1
Sequence:CCGGCGGGCCTGTATACCGGATAATCTCGAGATTATCCGGTATACAGGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004304
VALIDATED
ALK MISSION shRNA Bacterial Glycerol Stock
anaplastic lymphoma receptor tyrosine kinase
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004304.x-5992s1c1
Sequence:CCGGGTGATAAATACAAGGCCCAGACTCGAGTCTGGGCCTTGTATTTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-3310s1c1
Sequence:CCGGAGAAGAAGAAATCCGTGTGAACTCGAGTTCACACGGATTTCTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-1572s1c1
Sequence:CCGGCTGGTCATAGCTCCTTGGAATCTCGAGATTCCAAGGAGCTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004304.x-2854s1c1
Sequence:CCGGACCCAAATCAAGAAACCTGTTCTCGAGAACAGGTTTCTTGATTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-2842s1c1
Sequence:CCGGGCAGAATACAGCACCCAAATCCTCGAGGATTTGGGTGCTGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004304.3-6046s1c1
Sequence:CCGGGTATACTTCCTTATGCTTCTTCTCGAGAAGAAGCATAAGGAAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-5586s1c1
Sequence:CCGGCTTCGCTGACTGCCAATATGACTCGAGTCATATTGGCAGTCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3508s21c1
Sequence:CCGGTCTAGGGCTAAACGGCAATTCCTCGAGGAATTGCCGTTTAGCCCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-1974s21c1
Sequence:CCGGAGCCCTCTGGAAGGTACATTGCTCGAGCAATGTACCTTCCAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3372s21c1
Sequence:CCGGGTGGAGCCACCTACGTATTTACTCGAGTAAATACGTAGGTGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5791s21c1
Sequence:CCGGCTCTTCCTTGGGATCCCTAAGCTCGAGCTTAGGGATCCCAAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-4769s21c1
Sequence:CCGGTGTGCCATGCTGCCAGTTAAGCTCGAGCTTAACTGGCAGCATGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5842s21c1
Sequence:CCGGTCACAAACCAGAGACCAAATGCTCGAGCATTTGGTCTCTGGTTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5940s21c1
Sequence:CCGGTGAGCATGGGTTCATCCTATTCTCGAGAATAGGATGAACCCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004304
VALIDATED
ALK MISSION shRNA shRNA Plasmid DNA
anaplastic lymphoma receptor tyrosine kinase
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004304.x-5992s1c1
Sequence:CCGGGTGATAAATACAAGGCCCAGACTCGAGTCTGGGCCTTGTATTTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-3310s1c1
Sequence:CCGGAGAAGAAGAAATCCGTGTGAACTCGAGTTCACACGGATTTCTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-1572s1c1
Sequence:CCGGCTGGTCATAGCTCCTTGGAATCTCGAGATTCCAAGGAGCTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004304.x-2854s1c1
Sequence:CCGGACCCAAATCAAGAAACCTGTTCTCGAGAACAGGTTTCTTGATTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-2842s1c1
Sequence:CCGGGCAGAATACAGCACCCAAATCCTCGAGGATTTGGGTGCTGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004304.3-6046s1c1
Sequence:CCGGGTATACTTCCTTATGCTTCTTCTCGAGAAGAAGCATAAGGAAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-5586s1c1
Sequence:CCGGCTTCGCTGACTGCCAATATGACTCGAGTCATATTGGCAGTCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3508s21c1
Sequence:CCGGTCTAGGGCTAAACGGCAATTCCTCGAGGAATTGCCGTTTAGCCCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-1974s21c1
Sequence:CCGGAGCCCTCTGGAAGGTACATTGCTCGAGCAATGTACCTTCCAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3372s21c1
Sequence:CCGGGTGGAGCCACCTACGTATTTACTCGAGTAAATACGTAGGTGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5791s21c1
Sequence:CCGGCTCTTCCTTGGGATCCCTAAGCTCGAGCTTAGGGATCCCAAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-4769s21c1
Sequence:CCGGTGTGCCATGCTGCCAGTTAAGCTCGAGCTTAACTGGCAGCATGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5842s21c1
Sequence:CCGGTCACAAACCAGAGACCAAATGCTCGAGCATTTGGTCTCTGGTTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5940s21c1
Sequence:CCGGTGAGCATGGGTTCATCCTATTCTCGAGAATAGGATGAACCCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004304
VALIDATED
ALK MISSION shRNA Lentiviral Transduction Particles
anaplastic lymphoma receptor tyrosine kinase
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004304.x-5992s1c1
Sequence:CCGGGTGATAAATACAAGGCCCAGACTCGAGTCTGGGCCTTGTATTTATCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-3310s1c1
Sequence:CCGGAGAAGAAGAAATCCGTGTGAACTCGAGTTCACACGGATTTCTTCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004304.x-1572s1c1
Sequence:CCGGCTGGTCATAGCTCCTTGGAATCTCGAGATTCCAAGGAGCTATGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004304.x-2854s1c1
Sequence:CCGGACCCAAATCAAGAAACCTGTTCTCGAGAACAGGTTTCTTGATTTGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-2842s1c1
Sequence:CCGGGCAGAATACAGCACCCAAATCCTCGAGGATTTGGGTGCTGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196366    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004304.3-6046s1c1
Sequence:CCGGGTATACTTCCTTATGCTTCTTCTCGAGAAGAAGCATAAGGAAGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004304.3-5586s1c1
Sequence:CCGGCTTCGCTGACTGCCAATATGACTCGAGTCATATTGGCAGTCAGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3508s21c1
Sequence:CCGGTCTAGGGCTAAACGGCAATTCCTCGAGGAATTGCCGTTTAGCCCTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-1974s21c1
Sequence:CCGGAGCCCTCTGGAAGGTACATTGCTCGAGCAATGTACCTTCCAGAGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-3372s21c1
Sequence:CCGGGTGGAGCCACCTACGTATTTACTCGAGTAAATACGTAGGTGGCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5791s21c1
Sequence:CCGGCTCTTCCTTGGGATCCCTAAGCTCGAGCTTAGGGATCCCAAGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004304.3-4769s21c1
Sequence:CCGGTGTGCCATGCTGCCAGTTAAGCTCGAGCTTAACTGGCAGCATGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426445    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5842s21c1
Sequence:CCGGTCACAAACCAGAGACCAAATGCTCGAGCATTTGGTCTCTGGTTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004304.3-5940s21c1
Sequence:CCGGTGAGCATGGGTTCATCCTATTCTCGAGAATAGGATGAACCCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks