EMAIL THIS PAGE TO A FRIEND

ALKBH1

alkB, alkylation repair homolog 1 (E. coli)

80 Gene Product Result for
Synonyms: ABH ABH1 ALKBH alkB hABH
UniProtKB ID: Q13686, Q8TAU1, Q9ULA7
Gene ID:
Human(8846) Summary: This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]
Mouse(211064) alkB, alkylation repair homolog 1 (E. coli)
Rat(362766) alkB, alkylation repair homolog 1 (E. coli)
Zebrafish(553720) alkB, alkylation repair homolog 1 (E. coli)
dog(480404) alkB, alkylation repair homolog 1 (E. coli)
cow(538733) alkB, alkylation repair homolog 1 (E. coli)
Horse(100059544) alkB, alkylation repair homolog 1 (E. coli)
domestic cat(101081308) alkB, alkylation repair homolog 1 (E. coli)
chicken(428898) alkB, alkylation repair homolog 1 (E. coli)
sheep(101111374) alkB, alkylation repair homolog 1 (E. coli)
domestic guinea pig(100719886) alkB, alkylation repair homolog 1 (E. coli)
naked mole-rat(101701049) alkB, alkylation repair homolog 1 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001102565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001102565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006020 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039506 Rosetta Predictions human pricing
NM_006020 Rosetta Predictions human pricing
NM_001108718 Rosetta Predictions rat pricing
NM_001102565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150338 predicted 534
2 SASI_Hs01_00150339 predicted 567
3 SASI_Hs01_00150340 predicted 788
4 SASI_Hs01_00150341 predicted 774
5 SASI_Hs01_00150342 predicted 556
6 SASI_Hs01_00150343 predicted 686
7 SASI_Hs01_00150344 predicted 664
8 SASI_Hs01_00150345 predicted 597
9 SASI_Hs01_00150346 predicted 404
10 SASI_Hs01_00150347 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340737 predicted 355
2 SASI_Hs02_00340738 predicted 428
3 SASI_Hs01_00120273 predicted 842
4 SASI_Hs02_00340739 predicted 557
5 SASI_Hs02_00340740 predicted 531
6 SASI_Hs02_00340741 predicted 449
7 SASI_Hs02_00340742 predicted 404
8 SASI_Hs01_00120278 predicted 950
9 SASI_Hs02_00340743 predicted 343
10 SASI_Hs02_00340744 predicted 608
11 SASI_Hs01_00120272 predicted 1458
12 SASI_Hs01_00120274 predicted 1607
13 SASI_Hs01_00120275 predicted 1383
14 SASI_Hs01_00120276 predicted 1393
15 SASI_Hs01_00120277 predicted 1295
16 SASI_Hs01_00120279 predicted 1425
17 SASI_Hs01_00120280 predicted 1330
18 SASI_Hs01_00120281 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108718 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241395 predicted 536
2 SASI_Rn02_00241396 predicted 283
3 SASI_Rn02_00241397 predicted 449
4 SASI_Rn02_00241398 predicted 464
5 SASI_Rn02_00241399 predicted 701
6 SASI_Rn02_00241400 predicted 288
7 SASI_Rn02_00241401 predicted 267
8 SASI_Rn02_00241402 predicted 336
9 SASI_Rn02_00241403 predicted 225
10 SASI_Rn02_00241404 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302943 predicted 1007
2 SASI_Mm02_00302944 predicted 250
3 SASI_Mm02_00302945 predicted 367
4 SASI_Mm02_00302946 predicted 553
5 SASI_Mm02_00302947 predicted 566
6 SASI_Mm02_00302948 predicted 847
7 SASI_Mm02_00302949 predicted 1197
8 SASI_Mm02_00302950 predicted 209
9 SASI_Mm02_00302951 predicted 843
10 SASI_Mm02_00302952 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102565
ALKBH1 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 1 (E. coli)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-561s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-527s21c1
Sequence:CCGGTCACCCTGGGCTACCATTATACTCGAGTATAATGGTAGCCCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102565.1-1597s21c1
Sequence:CCGGACCTCCTCCTAGTCGTCAAATCTCGAGATTTGACGACTAGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-1127s21c1
Sequence:CCGGGCCATCTGCATGACCCGAATACTCGAGTATTCGGGTCATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102565
ALKBH1 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 1 (E. coli)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-561s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-527s21c1
Sequence:CCGGTCACCCTGGGCTACCATTATACTCGAGTATAATGGTAGCCCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102565.1-1597s21c1
Sequence:CCGGACCTCCTCCTAGTCGTCAAATCTCGAGATTTGACGACTAGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-1127s21c1
Sequence:CCGGGCCATCTGCATGACCCGAATACTCGAGTATTCGGGTCATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102565
ALKBH1 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 1 (E. coli)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-561s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-527s21c1
Sequence:CCGGTCACCCTGGGCTACCATTATACTCGAGTATAATGGTAGCCCAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001102565.1-1597s21c1
Sequence:CCGGACCTCCTCCTAGTCGTCAAATCTCGAGATTTGACGACTAGGAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102565.1-1127s21c1
Sequence:CCGGGCCATCTGCATGACCCGAATACTCGAGTATTCGGGTCATGCAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006020
VALIDATED
ALKBH1 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 1 (E. coli)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1131s21c1
Sequence:CCGGTGACCAGAATAGCGAAGTAAACTCGAGTTTACTTCGCTATTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-522s21c1
Sequence:CCGGGACCGTAGGCTACCATTATAACTCGAGTTATAATGGTAGCCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-555s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006020.2-1559s21c1
Sequence:CCGGCTCCACTCCATCTGGTAATTTCTCGAGAAATTACCAGATGGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1008s21c1
Sequence:CCGGCTTGAAGACCGCTCGTGTTAACTCGAGTTAACACGAGCGGTCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006020.1-1551s1c1
Sequence:CCGGCCACTCCATCTGGTAATTTATCTCGAGATAAATTACCAGATGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006020
VALIDATED
ALKBH1 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 1 (E. coli)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1131s21c1
Sequence:CCGGTGACCAGAATAGCGAAGTAAACTCGAGTTTACTTCGCTATTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-522s21c1
Sequence:CCGGGACCGTAGGCTACCATTATAACTCGAGTTATAATGGTAGCCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-555s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006020.2-1559s21c1
Sequence:CCGGCTCCACTCCATCTGGTAATTTCTCGAGAAATTACCAGATGGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1008s21c1
Sequence:CCGGCTTGAAGACCGCTCGTGTTAACTCGAGTTAACACGAGCGGTCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006020.1-1551s1c1
Sequence:CCGGCCACTCCATCTGGTAATTTATCTCGAGATAAATTACCAGATGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006020
VALIDATED
ALKBH1 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 1 (E. coli)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1131s21c1
Sequence:CCGGTGACCAGAATAGCGAAGTAAACTCGAGTTTACTTCGCTATTCTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-522s21c1
Sequence:CCGGGACCGTAGGCTACCATTATAACTCGAGTTATAATGGTAGCCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-555s21c1
Sequence:CCGGGAAATACTCAGCAGATCATTACTCGAGTAATGATCTGCTGAGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006020.2-1559s21c1
Sequence:CCGGCTCCACTCCATCTGGTAATTTCTCGAGAAATTACCAGATGGAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006020.2-1008s21c1
Sequence:CCGGCTTGAAGACCGCTCGTGTTAACTCGAGTTAACACGAGCGGTCTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006020.1-1551s1c1
Sequence:CCGGCCACTCCATCTGGTAATTTATCTCGAGATAAATTACCAGATGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks