EMAIL THIS PAGE TO A FRIEND

ALKBH2

alkB, alkylation repair homolog 2 (E. coli)

49 Gene Product Result for
Synonyms: ABH2
UniProtKB ID: Q6NS38, A4PET2, Q5XLE3
Gene ID:
Human(121642) Summary: The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 and ALKBH3 (MIM 610603) are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]
Mouse(231642) alkB, alkylation repair homolog 2 (E. coli)
Rat(304578) alkB, alkylation repair homolog 2 (E. coli)
naked mole-rat(101716220) alkB, alkylation repair homolog 2 (E. coli)
domestic guinea pig(100731606) alkB, alkylation repair homolog 2 (E. coli)
sheep(101115575) alkB, alkylation repair homolog 2 (E. coli)
Zebrafish(569291) alkB, alkylation repair homolog 2 (E. coli)
cow(511380) alkB, alkylation repair homolog 2 (E. coli)
domestic cat(101086929) alkB, alkylation repair homolog 2 (E. coli)
dog(477524) alkB, alkylation repair homolog 2 (E. coli)
chicken(416897) alkB, alkylation repair homolog 2 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001655 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU061431 MISSION® esiRNA esiRNA targeting mouse Alkbh2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001655 Rosetta Predictions human pricing
NM_001126273 Rosetta Predictions rat pricing
NM_175016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137231 predicted 641
2 SASI_Hs01_00137232 predicted 655
3 SASI_Hs02_00303849 predicted 699
4 SASI_Hs01_00137233 predicted 248
5 SASI_Hs01_00137234 predicted 512
6 SASI_Hs02_00303850 predicted 487
7 SASI_Hs01_00137235 predicted 242
8 SASI_Hs01_00137236 predicted 659
9 SASI_Hs01_00137237 predicted 627
10 SASI_Hs01_00137238 predicted 387
11 SASI_Hs01_00137239 predicted 668
12 SASI_Hs01_00137240 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253103 predicted 974
2 SASI_Rn02_00253104 predicted 855
3 SASI_Rn02_00253105 predicted 909
4 SASI_Rn02_00253106 predicted 793
5 SASI_Rn02_00253107 predicted 569
6 SASI_Rn02_00253108 predicted 829
7 SASI_Rn02_00253109 predicted 591
8 SASI_Rn02_00253110 predicted 602
9 SASI_Rn02_00253111 predicted 587
10 SASI_Rn02_00253112 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067004 predicted 639
2 SASI_Mm01_00067005 predicted 712
3 SASI_Mm01_00067006 predicted 682
4 SASI_Mm01_00067007 predicted 456
5 SASI_Mm01_00067008 predicted 704
6 SASI_Mm02_00345590 predicted 666
7 SASI_Mm01_00067009 predicted 512
8 SASI_Mm01_00067010 predicted 570
9 SASI_Mm01_00067011 predicted 564
10 SASI_Mm01_00067012 predicted 772
11 SASI_Mm01_00067013 predicted 463
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001655
VALIDATED
ALKBH2 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 2 (E. coli)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-661s1c1
Sequence:CCGGGTGCTCATCAACAGGTATAAACTCGAGTTTATACCTGTTGATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-446s1c1
Sequence:CCGGAGTTGGAGAAAGAAGTAGAATCTCGAGATTCTACTTCTTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-852s1c1
Sequence:CCGGCCACGGGAGCTTACTAATGATCTCGAGATCATTAGTAAGCTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-520s1c1
Sequence:CCGGCCCAGGAAGCAGGCAACGTATCTCGAGATACGTTGCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-790s1c1
Sequence:CCGGCATAAGGATTCCCGTGGGAAACTCGAGTTTCCCACGGGAATCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-752s21c1
Sequence:CCGGAGCACCGAGATGATGAAAGAGCTCGAGCTCTTTCATCATCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-918s21c1
Sequence:CCGGGATGAACCACCCGACCAACACCTCGAGGTGTTGGTCGGGTGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-981s21c1
Sequence:CCGGTCCACGGGTGAATCTGACTTTCTCGAGAAAGTCAGATTCACCCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-449s21c1
Sequence:CCGGACACAGTCCTGTTTGGCAAAGCTCGAGCTTTGCCAAACAGGACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-536s21c1
Sequence:CCGGGAGTCCAGGTATTCGGGAAGTCTCGAGACTTCCCGAATACCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001655
VALIDATED
ALKBH2 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 2 (E. coli)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-661s1c1
Sequence:CCGGGTGCTCATCAACAGGTATAAACTCGAGTTTATACCTGTTGATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-446s1c1
Sequence:CCGGAGTTGGAGAAAGAAGTAGAATCTCGAGATTCTACTTCTTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-852s1c1
Sequence:CCGGCCACGGGAGCTTACTAATGATCTCGAGATCATTAGTAAGCTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-520s1c1
Sequence:CCGGCCCAGGAAGCAGGCAACGTATCTCGAGATACGTTGCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-790s1c1
Sequence:CCGGCATAAGGATTCCCGTGGGAAACTCGAGTTTCCCACGGGAATCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-752s21c1
Sequence:CCGGAGCACCGAGATGATGAAAGAGCTCGAGCTCTTTCATCATCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-918s21c1
Sequence:CCGGGATGAACCACCCGACCAACACCTCGAGGTGTTGGTCGGGTGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-981s21c1
Sequence:CCGGTCCACGGGTGAATCTGACTTTCTCGAGAAAGTCAGATTCACCCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-449s21c1
Sequence:CCGGACACAGTCCTGTTTGGCAAAGCTCGAGCTTTGCCAAACAGGACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-536s21c1
Sequence:CCGGGAGTCCAGGTATTCGGGAAGTCTCGAGACTTCCCGAATACCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001655
VALIDATED
ALKBH2 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 2 (E. coli)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-661s1c1
Sequence:CCGGGTGCTCATCAACAGGTATAAACTCGAGTTTATACCTGTTGATGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001655.1-446s1c1
Sequence:CCGGAGTTGGAGAAAGAAGTAGAATCTCGAGATTCTACTTCTTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-852s1c1
Sequence:CCGGCCACGGGAGCTTACTAATGATCTCGAGATCATTAGTAAGCTCCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-520s1c1
Sequence:CCGGCCCAGGAAGCAGGCAACGTATCTCGAGATACGTTGCCTGCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001655.1-790s1c1
Sequence:CCGGCATAAGGATTCCCGTGGGAAACTCGAGTTTCCCACGGGAATCCTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-752s21c1
Sequence:CCGGAGCACCGAGATGATGAAAGAGCTCGAGCTCTTTCATCATCTCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-918s21c1
Sequence:CCGGGATGAACCACCCGACCAACACCTCGAGGTGTTGGTCGGGTGGTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-981s21c1
Sequence:CCGGTCCACGGGTGAATCTGACTTTCTCGAGAAAGTCAGATTCACCCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-449s21c1
Sequence:CCGGACACAGTCCTGTTTGGCAAAGCTCGAGCTTTGCCAAACAGGACTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001655.2-536s21c1
Sequence:CCGGGAGTCCAGGTATTCGGGAAGTCTCGAGACTTCCCGAATACCTGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175016
VALIDATED
ALKBH2 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 2 (E. coli)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-299s1c1
Sequence:CCGGGCTGTGATTACACCGTCCTATCTCGAGATAGGACGGTGTAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-671s1c1
Sequence:CCGGGCGCTTGCAGAGACTTCATTTCTCGAGAAATGAAGTCTCTGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-732s21c1
Sequence:CCGGTACTCGTGAACAGGTACAAAGCTCGAGCTTTGTACCTGTTCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-520s21c1
Sequence:CCGGGGAGCAAGAAGTGGAGTATTTCTCGAGAAATACTCCACTTCTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-464s21c1
Sequence:CCGGTGTGATTACACCGTCCTATTCCTCGAGGAATAGGACGGTGTAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-641s21c1
Sequence:CCGGGGTCTTACCCTGACACCAAAGCTCGAGCTTTGGTGTCAGGGTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-558s21c1
Sequence:CCGGAGGTCCAGGTGTTCGGAAAGTCTCGAGACTTTCCGAACACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175016
VALIDATED
ALKBH2 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 2 (E. coli)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-299s1c1
Sequence:CCGGGCTGTGATTACACCGTCCTATCTCGAGATAGGACGGTGTAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-671s1c1
Sequence:CCGGGCGCTTGCAGAGACTTCATTTCTCGAGAAATGAAGTCTCTGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-732s21c1
Sequence:CCGGTACTCGTGAACAGGTACAAAGCTCGAGCTTTGTACCTGTTCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-520s21c1
Sequence:CCGGGGAGCAAGAAGTGGAGTATTTCTCGAGAAATACTCCACTTCTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-464s21c1
Sequence:CCGGTGTGATTACACCGTCCTATTCCTCGAGGAATAGGACGGTGTAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-641s21c1
Sequence:CCGGGGTCTTACCCTGACACCAAAGCTCGAGCTTTGGTGTCAGGGTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-558s21c1
Sequence:CCGGAGGTCCAGGTGTTCGGAAAGTCTCGAGACTTTCCGAACACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175016
VALIDATED
ALKBH2 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 2 (E. coli)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-299s1c1
Sequence:CCGGGCTGTGATTACACCGTCCTATCTCGAGATAGGACGGTGTAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175016.1-671s1c1
Sequence:CCGGGCGCTTGCAGAGACTTCATTTCTCGAGAAATGAAGTCTCTGCAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-732s21c1
Sequence:CCGGTACTCGTGAACAGGTACAAAGCTCGAGCTTTGTACCTGTTCACGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-520s21c1
Sequence:CCGGGGAGCAAGAAGTGGAGTATTTCTCGAGAAATACTCCACTTCTTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-464s21c1
Sequence:CCGGTGTGATTACACCGTCCTATTCCTCGAGGAATAGGACGGTGTAATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175016.2-641s21c1
Sequence:CCGGGGTCTTACCCTGACACCAAAGCTCGAGCTTTGGTGTCAGGGTAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175016.2-558s21c1
Sequence:CCGGAGGTCCAGGTGTTCGGAAAGTCTCGAGACTTTCCGAACACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks