EMAIL THIS PAGE TO A FRIEND

ALKBH3

alkB, alkylation repair homolog 3 (E. coli)

Synonyms: ABH3 DEPC-1 DEPC1 PCA1
UniProtKB ID: Q96Q83, A6NDJ1, Q3SYI0, Q6NX57, Q96BU8
Gene ID:
Human(221120) Summary: The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]
Mouse(69113) alkB, alkylation repair homolog 3 (E. coli)
Rat(362169) alkB, alkylation repair homolog 3 (E. coli)
Zebrafish(792266) alkB, alkylation repair homolog 3 (E. coli)
cow(514579) alkB, alkylation repair homolog 3 (E. coli)
domestic cat(101082850) alkB, alkylation repair homolog 3 (E. coli)
dog(475938) alkB, alkylation repair homolog 3 (E. coli)
chicken(423169) alkB, alkylation repair homolog 3 (E. coli)
sheep(101110359) alkB, alkylation repair homolog 3 (E. coli)
domestic guinea pig(100721589) alkB, alkylation repair homolog 3 (E. coli)
naked mole-rat(101716978) alkB, alkylation repair homolog 3 (E. coli)
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064581 MISSION® esiRNA esiRNA human ALKBH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139178 Rosetta Predictions human pricing
NM_001014180 Rosetta Predictions rat pricing
NM_026944 Rosetta Predictions mouse pricing
XM_888102 Rosetta Predictions mouse pricing
XM_897898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023896 predicted 538
2 SASI_Hs01_00023897 predicted 1042
3 SASI_Hs01_00023898 predicted 756
4 SASI_Hs01_00023899 predicted 565
5 SASI_Hs02_00364218 predicted 770
6 SASI_Hs01_00023900 predicted 724
7 SASI_Hs01_00023901 predicted 837
8 SASI_Hs01_00023902 predicted 873
9 SASI_Hs01_00023903 predicted 1002
10 SASI_Hs01_00023904 predicted 1114
11 SASI_Hs01_00023905 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101504 predicted 944
2 SASI_Rn02_00201682 predicted 386
3 SASI_Rn01_00101505 predicted 735
4 SASI_Rn01_00101506 predicted 932
5 SASI_Rn02_00201683 predicted 537
6 SASI_Rn01_00101507 predicted 805
7 SASI_Rn01_00101509 predicted 609
8 SASI_Rn01_00101510 predicted 817
9 SASI_Rn01_00101511 predicted 493
10 SASI_Rn01_00101512 predicted 265
11 SASI_Rn01_00101508 predicted 568
12 SASI_Rn01_00101513 predicted 418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331237 predicted 549
2 SASI_Mm02_00331238 predicted 487
3 SASI_Mm02_00331239 predicted 893
4 SASI_Mm02_00331240 predicted 589
5 SASI_Mm02_00331241 predicted 256
6 SASI_Mm02_00331242 predicted 976
7 SASI_Mm02_00331243 predicted 345
8 SASI_Mm02_00331244 predicted 921
9 SASI_Mm02_00331245 predicted 476
10 SASI_Mm02_00331246 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244546 predicted 563
2 SASI_Mm01_00244547 predicted 980
3 SASI_Mm01_00244548 predicted 672
4 SASI_Mm01_00244549 predicted 345
5 SASI_Mm01_00244550 predicted 1061
6 SASI_Mm01_00244551 predicted 420
7 SASI_Mm01_00244552 predicted 995
8 SASI_Mm01_00244553 predicted 558
9 SASI_Mm01_00244554 predicted 608
10 SASI_Mm01_00244555 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280273 predicted 687
2 SASI_Mm01_00280274 predicted 683
3 SASI_Mm01_00280275 predicted 675
4 SASI_Mm01_00280276 predicted 675
5 SASI_Mm01_00280277 predicted 762
6 SASI_Mm01_00280278 predicted 682
7 SASI_Mm01_00280279 predicted 680
8 SASI_Mm01_00280280 predicted 677
9 SASI_Mm01_00280281 predicted 740
10 SASI_Mm01_00280282 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139178
VALIDATED
ALKBH3 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 3 (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-618s21c1
Sequence:CCGGCCTCAGCAGGTAGTACGTAGACTCGAGTCTACGTACTACCTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-822s21c1
Sequence:CCGGTATCAGCAACCAAGACTTACACTCGAGTGTAAGTCTTGGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1047s21c1
Sequence:CCGGCCCATTATTGCTTCACTAAGTCTCGAGACTTAGTGAAGCAATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1080s21c1
Sequence:CCGGCGCACATTTGAGATGAGAAAGCTCGAGCTTTCTCATCTCAAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1159s21c1
Sequence:CCGGTGGATCATGGGACCTTGTTAACTCGAGTTAACAAGGTCCCATGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139178.3-1380s21c1
Sequence:CCGGGCTGCTAGATCTCATGATGTGCTCGAGCACATCATGAGATCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-881s1c1
Sequence:CCGGCGCACACTAAAGAACCGCATTCTCGAGAATGCGGTTCTTTAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-762s1c1
Sequence:CCGGCCGGCATCAGAGAGGATATAACTCGAGTTATATCCTCTCTGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-1182s1c1
Sequence:CCGGTGCCCAAAGAATACCACTCTACTCGAGTAGAGTGGTATTCTTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-935s1c1
Sequence:CCGGCTCTGCAATCTTTATCGCAATCTCGAGATTGCGATAAAGATTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-674s1c1
Sequence:CCGGGTCTGTTTGTATCCTGGCTTTCTCGAGAAAGCCAGGATACAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139178
VALIDATED
ALKBH3 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 3 (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-618s21c1
Sequence:CCGGCCTCAGCAGGTAGTACGTAGACTCGAGTCTACGTACTACCTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-822s21c1
Sequence:CCGGTATCAGCAACCAAGACTTACACTCGAGTGTAAGTCTTGGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1047s21c1
Sequence:CCGGCCCATTATTGCTTCACTAAGTCTCGAGACTTAGTGAAGCAATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1080s21c1
Sequence:CCGGCGCACATTTGAGATGAGAAAGCTCGAGCTTTCTCATCTCAAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1159s21c1
Sequence:CCGGTGGATCATGGGACCTTGTTAACTCGAGTTAACAAGGTCCCATGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139178.3-1380s21c1
Sequence:CCGGGCTGCTAGATCTCATGATGTGCTCGAGCACATCATGAGATCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-881s1c1
Sequence:CCGGCGCACACTAAAGAACCGCATTCTCGAGAATGCGGTTCTTTAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-762s1c1
Sequence:CCGGCCGGCATCAGAGAGGATATAACTCGAGTTATATCCTCTCTGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-1182s1c1
Sequence:CCGGTGCCCAAAGAATACCACTCTACTCGAGTAGAGTGGTATTCTTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-935s1c1
Sequence:CCGGCTCTGCAATCTTTATCGCAATCTCGAGATTGCGATAAAGATTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-674s1c1
Sequence:CCGGGTCTGTTTGTATCCTGGCTTTCTCGAGAAAGCCAGGATACAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139178
VALIDATED
ALKBH3 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 3 (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-618s21c1
Sequence:CCGGCCTCAGCAGGTAGTACGTAGACTCGAGTCTACGTACTACCTGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-822s21c1
Sequence:CCGGTATCAGCAACCAAGACTTACACTCGAGTGTAAGTCTTGGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1047s21c1
Sequence:CCGGCCCATTATTGCTTCACTAAGTCTCGAGACTTAGTGAAGCAATAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1080s21c1
Sequence:CCGGCGCACATTTGAGATGAGAAAGCTCGAGCTTTCTCATCTCAAATGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139178.3-1159s21c1
Sequence:CCGGTGGATCATGGGACCTTGTTAACTCGAGTTAACAAGGTCCCATGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139178.3-1380s21c1
Sequence:CCGGGCTGCTAGATCTCATGATGTGCTCGAGCACATCATGAGATCTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-881s1c1
Sequence:CCGGCGCACACTAAAGAACCGCATTCTCGAGAATGCGGTTCTTTAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-762s1c1
Sequence:CCGGCCGGCATCAGAGAGGATATAACTCGAGTTATATCCTCTCTGATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-1182s1c1
Sequence:CCGGTGCCCAAAGAATACCACTCTACTCGAGTAGAGTGGTATTCTTTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_139178.1-935s1c1
Sequence:CCGGCTCTGCAATCTTTATCGCAATCTCGAGATTGCGATAAAGATTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139178.1-674s1c1
Sequence:CCGGGTCTGTTTGTATCCTGGCTTTCTCGAGAAAGCCAGGATACAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026944
VALIDATED
ALKBH3 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 3 (E. coli)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000251539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026944.1-379s21c1
Sequence:CCGGTGTCTAGGGTGTGCTTATATCCTCGAGGATATAAGCACACCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-262s21c1
Sequence:CCGGAGCAATGTGACCGACAATTTGCTCGAGCAAATTGTCGGTCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-911s21c1
Sequence:CCGGCTCCAGACAACCGAGAGTAAACTCGAGTTTACTCTCGGTTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-1066s21c1
Sequence:CCGGGTTCAGAAAGCGTGGTGTTTGCTCGAGCAAACACCACGCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026944
VALIDATED
ALKBH3 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 3 (E. coli)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000251539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026944.1-379s21c1
Sequence:CCGGTGTCTAGGGTGTGCTTATATCCTCGAGGATATAAGCACACCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-262s21c1
Sequence:CCGGAGCAATGTGACCGACAATTTGCTCGAGCAAATTGTCGGTCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-911s21c1
Sequence:CCGGCTCCAGACAACCGAGAGTAAACTCGAGTTTACTCTCGGTTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-1066s21c1
Sequence:CCGGGTTCAGAAAGCGTGGTGTTTGCTCGAGCAAACACCACGCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026944
VALIDATED
ALKBH3 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 3 (E. coli)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000251539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026944.1-379s21c1
Sequence:CCGGTGTCTAGGGTGTGCTTATATCCTCGAGGATATAAGCACACCCTAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-262s21c1
Sequence:CCGGAGCAATGTGACCGACAATTTGCTCGAGCAAATTGTCGGTCACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-911s21c1
Sequence:CCGGCTCCAGACAACCGAGAGTAAACTCGAGTTTACTCTCGGTTGTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026944.1-1066s21c1
Sequence:CCGGGTTCAGAAAGCGTGGTGTTTGCTCGAGCAAACACCACGCTTTCTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks