EMAIL THIS PAGE TO A FRIEND

ALKBH4

alkB, alkylation repair homolog 4 (E. coli)

83 Gene Product Result for
Synonyms: ABH4
UniProtKB ID: Q9NXW9, Q53H92, Q9H6A4
Gene ID:
Mouse(72041) alkB, alkylation repair homolog 4 (E. coli)
Rat(288587) alkB, alkylation repair homolog 4 (E. coli)
Zebrafish(553475) alkB, alkylation repair homolog 4 (E. coli)
cow(512094) alkB, alkylation repair homolog 4 (E. coli)
domestic cat(101090916) alkB, alkylation repair homolog 4 (E. coli)
dog(608093) alkB, alkylation repair homolog 4 (E. coli)
chicken(417510) alkB, alkylation repair homolog 4 (E. coli)
naked mole-rat(101718060) alkB, alkylation repair homolog 4 (E. coli)
domestic guinea pig(100730732) alkB, alkylation repair homolog 4 (E. coli)
sheep(101117557) alkB, alkylation repair homolog 4 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017621 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018521 MISSION® esiRNA esiRNA targeting human ALKBH4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017621 Rosetta Predictions human pricing
NM_001105920 Rosetta Predictions rat pricing
NM_028070 Rosetta Predictions mouse pricing
XM_132400 Rosetta Predictions mouse pricing
XM_901319 Rosetta Predictions mouse pricing
XM_901322 Rosetta Predictions mouse pricing
XM_901334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350293 predicted 917
2 SASI_Hs01_00215507 predicted 252
3 SASI_Hs01_00215508 predicted 213
4 SASI_Hs01_00215509 predicted 938
5 SASI_Hs01_00215510 predicted 930
6 SASI_Hs01_00215511 predicted 943
7 SASI_Hs01_00215512 predicted 900
8 SASI_Hs01_00215513 predicted 768
9 SASI_Hs01_00215515 predicted 941
10 SASI_Hs01_00215516 predicted 672
11 SASI_Hs01_00215514 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213842 predicted 920
2 SASI_Rn02_00213843 predicted 269
3 SASI_Rn02_00213844 predicted 1395
4 SASI_Rn02_00213845 predicted 640
5 SASI_Rn02_00213846 predicted 235
6 SASI_Rn02_00213847 predicted 925
7 SASI_Rn02_00213848 predicted 1212
8 SASI_Rn02_00213849 predicted 233
9 SASI_Rn02_00213850 predicted 1209
10 SASI_Rn02_00213851 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333276 predicted 1009
2 SASI_Mm02_00333277 predicted 270
3 SASI_Mm02_00333278 predicted 1131
4 SASI_Mm02_00333279 predicted 999
5 SASI_Mm02_00333280 predicted 1070
6 SASI_Mm02_00333281 predicted 1009
7 SASI_Mm02_00333282 predicted 267
8 SASI_Mm02_00333283 predicted 1032
9 SASI_Mm02_00333284 predicted 1200
10 SASI_Mm02_00333285 predicted 1068
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281520 predicted 794
2 SASI_Mm01_00281521 predicted 1084
3 SASI_Mm01_00281522 predicted 1207
4 SASI_Mm01_00281523 predicted 1074
5 SASI_Mm01_00281524 predicted 1144
6 SASI_Mm01_00281525 predicted 1339
7 SASI_Mm01_00281526 predicted 1086
8 SASI_Mm01_00281527 predicted 1105
9 SASI_Mm01_00281528 predicted 957
10 SASI_Mm01_00281529 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269040 predicted 662
2 SASI_Mm01_00269041 predicted 957
3 SASI_Mm01_00269042 predicted 1088
4 SASI_Mm01_00269043 predicted 948
5 SASI_Mm01_00269044 predicted 1022
6 SASI_Mm01_00269045 predicted 1207
7 SASI_Mm01_00269046 predicted 957
8 SASI_Mm01_00269047 predicted 988
9 SASI_Mm01_00269048 predicted 835
10 SASI_Mm01_00269049 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235051 predicted 878
2 SASI_Mm01_00235052 predicted 1179
3 SASI_Mm01_00235053 predicted 1303
4 SASI_Mm01_00235054 predicted 1168
5 SASI_Mm01_00235055 predicted 1236
6 SASI_Mm01_00235056 predicted 1430
7 SASI_Mm01_00235057 predicted 1175
8 SASI_Mm01_00235058 predicted 1199
9 SASI_Mm01_00235059 predicted 1051
10 SASI_Mm01_00235060 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266300 predicted 1011
2 SASI_Mm01_00266301 predicted 276
3 SASI_Mm01_00266302 predicted 1146
4 SASI_Mm01_00266303 predicted 1005
5 SASI_Mm01_00266304 predicted 1067
6 SASI_Mm01_00266305 predicted 1016
7 SASI_Mm01_00266306 predicted 1034
8 SASI_Mm01_00266307 predicted 1208
9 SASI_Mm01_00266308 predicted 1076
10 SASI_Mm01_00266309 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017621
VALIDATED
ALKBH4 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 4 (E. coli)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-224s1c1
Sequence:CCGGGATGCTGATCGAGGACTTTGTCTCGAGACAAAGTCCTCGATCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-222s1c1
Sequence:CCGGGTGATGCTGATCGAGGACTTTCTCGAGAAAGTCCTCGATCAGCATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-337s1c1
Sequence:CCGGCCAAAGTCAACTTTCGGAAACCTCGAGGTTTCCGAAAGTTGACTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-353s1c1
Sequence:CCGGGAAACAGAAGCTAAAGACCGACTCGAGTCGGTCTTTAGCTTCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-133s1c1
Sequence:CCGGCATACCGTTTCATTTACTGCTCTCGAGAGCAGTAAATGAAACGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-347s1c1
Sequence:CCGGCTTTCGGAAACAGAAGCTAAACTCGAGTTTAGCTTCTGTTTCCGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-336s1c1
Sequence:CCGGCCCAAAGTCAACTTTCGGAAACTCGAGTTTCCGAAAGTTGACTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-1238s1c1
Sequence:CCGGGATCACTTGATGCCAGGAGTTCTCGAGAACTCCTGGCATCAAGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017621.2-938s1c1
Sequence:CCGGGACTGATCCCGGGATTGAAATCTCGAGATTTCAATCCCGGGATCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-643s1c1
Sequence:CCGGCCTTGGTGGACAGCGTGATAGCTCGAGCTATCACGCTGTCCACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017621
VALIDATED
ALKBH4 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 4 (E. coli)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-224s1c1
Sequence:CCGGGATGCTGATCGAGGACTTTGTCTCGAGACAAAGTCCTCGATCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-222s1c1
Sequence:CCGGGTGATGCTGATCGAGGACTTTCTCGAGAAAGTCCTCGATCAGCATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-337s1c1
Sequence:CCGGCCAAAGTCAACTTTCGGAAACCTCGAGGTTTCCGAAAGTTGACTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-353s1c1
Sequence:CCGGGAAACAGAAGCTAAAGACCGACTCGAGTCGGTCTTTAGCTTCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-133s1c1
Sequence:CCGGCATACCGTTTCATTTACTGCTCTCGAGAGCAGTAAATGAAACGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-347s1c1
Sequence:CCGGCTTTCGGAAACAGAAGCTAAACTCGAGTTTAGCTTCTGTTTCCGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-336s1c1
Sequence:CCGGCCCAAAGTCAACTTTCGGAAACTCGAGTTTCCGAAAGTTGACTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-1238s1c1
Sequence:CCGGGATCACTTGATGCCAGGAGTTCTCGAGAACTCCTGGCATCAAGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017621.2-938s1c1
Sequence:CCGGGACTGATCCCGGGATTGAAATCTCGAGATTTCAATCCCGGGATCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-643s1c1
Sequence:CCGGCCTTGGTGGACAGCGTGATAGCTCGAGCTATCACGCTGTCCACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017621
VALIDATED
ALKBH4 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 4 (E. coli)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-224s1c1
Sequence:CCGGGATGCTGATCGAGGACTTTGTCTCGAGACAAAGTCCTCGATCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-222s1c1
Sequence:CCGGGTGATGCTGATCGAGGACTTTCTCGAGAAAGTCCTCGATCAGCATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-337s1c1
Sequence:CCGGCCAAAGTCAACTTTCGGAAACCTCGAGGTTTCCGAAAGTTGACTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-353s1c1
Sequence:CCGGGAAACAGAAGCTAAAGACCGACTCGAGTCGGTCTTTAGCTTCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-133s1c1
Sequence:CCGGCATACCGTTTCATTTACTGCTCTCGAGAGCAGTAAATGAAACGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-347s1c1
Sequence:CCGGCTTTCGGAAACAGAAGCTAAACTCGAGTTTAGCTTCTGTTTCCGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-336s1c1
Sequence:CCGGCCCAAAGTCAACTTTCGGAAACTCGAGTTTCCGAAAGTTGACTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1.5 Clone ID:NM_017621.2-1238s1c1
Sequence:CCGGGATCACTTGATGCCAGGAGTTCTCGAGAACTCCTGGCATCAAGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219993    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017621.2-938s1c1
Sequence:CCGGGACTGATCCCGGGATTGAAATCTCGAGATTTCAATCCCGGGATCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017621.2-643s1c1
Sequence:CCGGCCTTGGTGGACAGCGTGATAGCTCGAGCTATCACGCTGTCCACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028070
ALKBH4 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 4 (E. coli)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-722s21c1
Sequence:CCGGATCCACCGCAGACACATCAAGCTCGAGCTTGATGTGTCTGCGGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-361s21c1
Sequence:CCGGAGTCCAGAGAATGGGCCTTTACTCGAGTAAAGGCCCATTCTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-279s21c1
Sequence:CCGGACTATGGCCCTAAAGTTAATTCTCGAGAATTAACTTTAGGGCCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-577s21c1
Sequence:CCGGCTCCGTCAGACCTGATGCTTTCTCGAGAAAGCATCAGGTCTGACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028070.1-1545s21c1
Sequence:CCGGTCAGTACTTGGGACGAGTAAGCTCGAGCTTACTCGTCCCAAGTACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028070
ALKBH4 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 4 (E. coli)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-722s21c1
Sequence:CCGGATCCACCGCAGACACATCAAGCTCGAGCTTGATGTGTCTGCGGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-361s21c1
Sequence:CCGGAGTCCAGAGAATGGGCCTTTACTCGAGTAAAGGCCCATTCTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-279s21c1
Sequence:CCGGACTATGGCCCTAAAGTTAATTCTCGAGAATTAACTTTAGGGCCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-577s21c1
Sequence:CCGGCTCCGTCAGACCTGATGCTTTCTCGAGAAAGCATCAGGTCTGACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028070.1-1545s21c1
Sequence:CCGGTCAGTACTTGGGACGAGTAAGCTCGAGCTTACTCGTCCCAAGTACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028070
ALKBH4 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 4 (E. coli)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-722s21c1
Sequence:CCGGATCCACCGCAGACACATCAAGCTCGAGCTTGATGTGTCTGCGGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-361s21c1
Sequence:CCGGAGTCCAGAGAATGGGCCTTTACTCGAGTAAAGGCCCATTCTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-279s21c1
Sequence:CCGGACTATGGCCCTAAAGTTAATTCTCGAGAATTAACTTTAGGGCCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028070.1-577s21c1
Sequence:CCGGCTCCGTCAGACCTGATGCTTTCTCGAGAAAGCATCAGGTCTGACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028070.1-1545s21c1
Sequence:CCGGTCAGTACTTGGGACGAGTAAGCTCGAGCTTACTCGTCCCAAGTACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)