EMAIL THIS PAGE TO A FRIEND

ALKBH5

alkB, alkylation repair homolog 5 (E. coli)

134 Gene Product Result for
Synonyms: ABH5 OFOXD OFOXD1
UniProtKB ID: Q6P6C2, B4DVJ4, D3DXC6, Q9NXD6
Gene ID:
Mouse(268420) alkB, alkylation repair homolog 5 (E. coli)
Rat(303193) alkB, alkylation repair homolog 5 (E. coli)
sheep(101111111) alkB, alkylation repair homolog 5 (E. coli)
domestic guinea pig(100732740) alkB, alkylation repair homolog 5 (E. coli)
naked mole-rat(101706740) alkB, alkylation repair homolog 5 (E. coli)
Zebrafish(570158) alkB, alkylation repair homolog 5 (E. coli)
cow(533303) alkB, alkylation repair homolog 5 (E. coli)
domestic cat(101100260) alkB, alkylation repair homolog 5 (E. coli)
dog(609383) alkB, alkylation repair homolog 5 (E. coli)
chicken(770703) alkB, alkylation repair homolog 5 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017758 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021751 MISSION® esiRNA esiRNA human ALKBH5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017758 Rosetta Predictions human pricing
XM_001077537 Rosetta Predictions rat pricing
XM_220525 Rosetta Predictions rat pricing
NM_172943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350577 predicted 1700
2 SASI_Hs01_00013940 predicted 1371
3 SASI_Hs01_00013942 predicted 1609
4 SASI_Hs01_00013943 predicted 2261
5 SASI_Hs01_00013947 predicted 1440
6 SASI_Hs01_00013948 predicted 1581
7 SASI_Hs01_00013949 predicted 2247
8 SASI_Hs02_00350578 predicted 2301
9 SASI_Hs02_00350579 predicted 1339
10 SASI_Hs02_00350580 predicted 1460
11 SASI_Hs01_00013941 predicted 1044
12 SASI_Hs01_00013944 predicted 1849
13 SASI_Hs01_00013945 predicted 684
14 SASI_Hs01_00013946 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357466 predicted 1780
2 SASI_Rn02_00357467 predicted 1884
3 SASI_Rn02_00357468 predicted 1898
4 SASI_Rn02_00357469 predicted 1735
5 SASI_Rn02_00357470 predicted 1770
6 SASI_Rn02_00357471 predicted 1118
7 SASI_Rn02_00357472 predicted 1840
8 SASI_Rn02_00357473 predicted 1762
9 SASI_Rn02_00357474 predicted 1110
10 SASI_Rn02_00357475 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379361 predicted 1782
2 SASI_Rn02_00379362 predicted 1888
3 SASI_Rn02_00379363 predicted 1903
4 SASI_Rn02_00379364 predicted 1735
5 SASI_Rn02_00379365 predicted 1770
6 SASI_Rn02_00379366 predicted 1111
7 SASI_Rn02_00379367 predicted 1844
8 SASI_Rn02_00379368 predicted 1758
9 SASI_Rn02_00379369 predicted 1118
10 SASI_Rn02_00379370 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106232 predicted 1410
2 SASI_Mm02_00344968 predicted 1758
3 SASI_Mm01_00106233 predicted 1664
4 SASI_Mm01_00106234 predicted 1509
5 SASI_Mm02_00344969 predicted 1571
6 SASI_Mm01_00106235 predicted 2327
7 SASI_Mm01_00106238 predicted 2397
8 SASI_Mm01_00106239 predicted 1637
9 SASI_Mm01_00106240 predicted 1509
10 SASI_Mm01_00106241 predicted 1415
11 SASI_Mm01_00106236 predicted 1164
12 SASI_Mm01_00106237 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172943
VALIDATED
ALKBH5 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 5 (E. coli)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2183s21c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1757s21c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2035s21c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1855s21c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1561s1c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1463s1c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1889s1c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172943.2-1741s1c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1233s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172943
VALIDATED
ALKBH5 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 5 (E. coli)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2183s21c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1757s21c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2035s21c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1855s21c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1561s1c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1463s1c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1889s1c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172943.2-1741s1c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1233s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172943
VALIDATED
ALKBH5 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 5 (E. coli)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2183s21c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1757s21c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172943.4-2035s21c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172943.4-1855s21c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1561s1c1
Sequence:CCGGCCTATGAGTCCTCGGAAGATTCTCGAGAATCTTCCGAGGACTCATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1463s1c1
Sequence:CCGGGATCCTGGAAATGGACAAAGACTCGAGTCTTTGTCCATTTCCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1889s1c1
Sequence:CCGGGCTGTCTTCAAGTGGAAGTTTCTCGAGAAACTTCCACTTGAAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172943.2-1741s1c1
Sequence:CCGGCCTTGCTTTGTTGACCATTAACTCGAGTTAATGGTCAACAAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172943.2-1233s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017758
VALIDATED
ALKBH5 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 5 (E. coli)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2063s21c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1475s21c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1534s21c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1598s21c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2096s21c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1592s1c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1112s1c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1625s1c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1053s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1176s1c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017758
VALIDATED
ALKBH5 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 5 (E. coli)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2063s21c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1475s21c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1534s21c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1598s21c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2096s21c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1592s1c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1112s1c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1625s1c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1053s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1176s1c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017758
VALIDATED
ALKBH5 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 5 (E. coli)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2063s21c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1475s21c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1534s21c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017758.3-1598s21c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307780    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017758.3-2096s21c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1592s1c1
Sequence:CCGGAGGTTCTCATATTCTTGGTATCTCGAGATACCAAGAATATGAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1112s1c1
Sequence:CCGGCCTCAGGAAGACAAGATTAGACTCGAGTCTAATCTTGTCTTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1625s1c1
Sequence:CCGGGAAAGGCTGTTGGCATCAATACTCGAGTATTGATGCCAACAGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1053s1c1
Sequence:CCGGGATGAAATCACTCACTGCATACTCGAGTATGCAGTGAGTGATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017758.2-1176s1c1
Sequence:CCGGCCACCCAGCTATGCTTCAGATCTCGAGATCTGAAGCATAGCTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks