EMAIL THIS PAGE TO A FRIEND

ALKBH6

alkB, alkylation repair homolog 6 (E. coli)

86 Gene Product Result for
Synonyms: ABH6
UniProtKB ID: Q3KRA9, A5LGM8, A6NLP1, A8MU96
Gene ID:
Mouse(233065) alkB, alkylation repair homolog 6 (E. coli)
Rat(292780) alkB, alkylation repair homolog 6 (E. coli)
Zebrafish(317736) alkB, alkylation repair homolog 6 (E. coli)
dog(612622) alkB, alkylation repair homolog 6 (E. coli)
cow(539257) alkB, alkylation repair homolog 6 (E. coli)
Horse(100060277) alkB, alkylation repair homolog 6 (E. coli)
domestic cat(101087627) alkB, alkylation repair homolog 6 (E. coli)
naked mole-rat(101709431) alkB, alkylation repair homolog 6 (E. coli)
domestic guinea pig(100714015) alkB, alkylation repair homolog 6 (E. coli)
sheep(101105845) alkB, alkylation repair homolog 6 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032878 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019311 MISSION® esiRNA esiRNA targeting mouse Alkbh6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032878 Rosetta Predictions human pricing
NM_198867 Rosetta Predictions human pricing
NM_001127450 Rosetta Predictions rat pricing
XM_214896 Rosetta Predictions rat pricing
NM_198027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360494 predicted 670
2 SASI_Hs01_00149294 predicted 724
3 SASI_Hs01_00149295 predicted 670
4 SASI_Hs01_00149296 predicted 734
5 SASI_Hs01_00149297 predicted 682
6 SASI_Hs02_00360495 predicted 733
7 SASI_Hs02_00360496 predicted 733
8 SASI_Hs01_00149298 predicted 379
9 SASI_Hs01_00149299 predicted 66
10 SASI_Hs02_00360497 predicted 244
11 SASI_Hs01_00149300 predicted 368
12 SASI_Hs01_00149301 predicted 363
13 SASI_Hs01_00149302 predicted 408
14 SASI_Hs01_00149303 predicted 157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372375 predicted 632
2 SASI_Hs01_00198936 predicted 691
3 SASI_Hs01_00198937 predicted 631
4 SASI_Hs01_00198938 predicted 694
5 SASI_Hs01_00198939 predicted 641
6 SASI_Hs02_00372376 predicted 694
7 SASI_Hs02_00372377 predicted 698
8 SASI_Hs01_00198941 predicted 337
9 SASI_Hs01_00198942 predicted 358
10 SASI_Hs01_00198943 predicted 69
11 SASI_Hs01_00198940 predicted 29
12 SASI_Hs01_00198944 predicted 171
13 SASI_Hs01_00198945 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253763 predicted 368
2 SASI_Rn02_00253764 predicted 425
3 SASI_Rn02_00253765 predicted 335
4 SASI_Rn02_00253766 predicted 456
5 SASI_Rn02_00253767 predicted 408
6 SASI_Rn02_00253768 predicted 420
7 SASI_Rn02_00253769 predicted 318
8 SASI_Rn02_00253770 predicted 431
9 SASI_Rn02_00253771 predicted 440
10 SASI_Rn02_00253772 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150463 predicted 660
2 SASI_Rn01_00150464 predicted 666
3 SASI_Rn01_00150465 predicted 660
4 SASI_Rn01_00150466 predicted 666
5 SASI_Rn01_00150467 predicted 683
6 SASI_Rn01_00150468 predicted 660
7 SASI_Rn01_00150469 predicted 704
8 SASI_Rn01_00150470 predicted 454
9 SASI_Rn01_00150471 predicted 358
10 SASI_Rn01_00150472 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125294 predicted 392
2 SASI_Mm01_00125295 predicted 355
3 SASI_Mm01_00125297 predicted 332
4 SASI_Mm02_00350761 predicted 435
5 SASI_Mm01_00125302 predicted 393
6 SASI_Mm02_00350762 predicted 347
7 SASI_Mm02_00350763 predicted 329
8 SASI_Mm02_00350764 predicted 428
9 SASI_Mm02_00350765 predicted 431
10 SASI_Mm01_00125296 predicted 489
11 SASI_Mm01_00125298 predicted 530
12 SASI_Mm01_00125299 predicted 513
13 SASI_Mm01_00125300 predicted 448
14 SASI_Mm01_00125301 predicted 457
15 SASI_Mm01_00125303 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198027
VALIDATED
ALKBH6 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 6 (E. coli)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-408s1c1
Sequence:CCGGCTTGTGAACCAGTATCTGCCTCTCGAGAGGCAGATACTGGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-512s1c1
Sequence:CCGGCGATTTCTATGAACCTCGACACTCGAGTGTCGAGGTTCATAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-162s1c1
Sequence:CCGGGCGCCACCTCTAATCTACTATCTCGAGATAGTAGATTAGAGGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-403s21c1
Sequence:CCGGATGTCCTTGTGAACCAGTATCCTCGAGGATACTGGTTCACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-343s21c1
Sequence:CCGGTTCAACGCTACGTGGACAAAGCTCGAGCTTTGTCCACGTAGCGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-497s21c1
Sequence:CCGGCTCCCATACTGTCCTCGATTTCTCGAGAAATCGAGGACAGTATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198027.2-163s21c1
Sequence:CCGGCGCCACCTCTAATCTACTATGCTCGAGCATAGTAGATTAGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-534s21c1
Sequence:CCGGCCAGACGATGATGTCCCTATGCTCGAGCATAGGGACATCATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198027
VALIDATED
ALKBH6 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 6 (E. coli)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-408s1c1
Sequence:CCGGCTTGTGAACCAGTATCTGCCTCTCGAGAGGCAGATACTGGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-512s1c1
Sequence:CCGGCGATTTCTATGAACCTCGACACTCGAGTGTCGAGGTTCATAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-162s1c1
Sequence:CCGGGCGCCACCTCTAATCTACTATCTCGAGATAGTAGATTAGAGGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-403s21c1
Sequence:CCGGATGTCCTTGTGAACCAGTATCCTCGAGGATACTGGTTCACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-343s21c1
Sequence:CCGGTTCAACGCTACGTGGACAAAGCTCGAGCTTTGTCCACGTAGCGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-497s21c1
Sequence:CCGGCTCCCATACTGTCCTCGATTTCTCGAGAAATCGAGGACAGTATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198027.2-163s21c1
Sequence:CCGGCGCCACCTCTAATCTACTATGCTCGAGCATAGTAGATTAGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-534s21c1
Sequence:CCGGCCAGACGATGATGTCCCTATGCTCGAGCATAGGGACATCATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198027
VALIDATED
ALKBH6 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 6 (E. coli)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-408s1c1
Sequence:CCGGCTTGTGAACCAGTATCTGCCTCTCGAGAGGCAGATACTGGTTCACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-512s1c1
Sequence:CCGGCGATTTCTATGAACCTCGACACTCGAGTGTCGAGGTTCATAGAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198027.2-162s1c1
Sequence:CCGGGCGCCACCTCTAATCTACTATCTCGAGATAGTAGATTAGAGGTGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-403s21c1
Sequence:CCGGATGTCCTTGTGAACCAGTATCCTCGAGGATACTGGTTCACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-343s21c1
Sequence:CCGGTTCAACGCTACGTGGACAAAGCTCGAGCTTTGTCCACGTAGCGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-497s21c1
Sequence:CCGGCTCCCATACTGTCCTCGATTTCTCGAGAAATCGAGGACAGTATGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198027.2-163s21c1
Sequence:CCGGCGCCACCTCTAATCTACTATGCTCGAGCATAGTAGATTAGAGGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198027.2-534s21c1
Sequence:CCGGCCAGACGATGATGTCCCTATGCTCGAGCATAGGGACATCATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032878
VALIDATED
ALKBH6 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 6 (E. coli)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032878.2-187s1c1
Sequence:CCGGGAAGAGGAGGAGTATTTGCTTCTCGAGAAGCAAATACTCCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-196s1c1
Sequence:CCGGGAGTATTTGCTTCGACAGGTTCTCGAGAACCTGTCGAAGCAAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-364s1c1
Sequence:CCGGGCTACGTGGACAAAGTGTCAACTCGAGTTGACACTTTGTCCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-72s1c1
Sequence:CCGGGTGCAAGGAGTTGGTGTTGATCTCGAGATCAACACCAACTCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-146s21c1
Sequence:CCGGCACCACCTGTAATCTACTATGCTCGAGCATAGTAGATTACAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-386s21c1
Sequence:CCGGATGTCCTCGTGAACCAGTATCCTCGAGGATACTGGTTCACGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-197s21c1
Sequence:GTACCGGAGTATTTGCTTCGACAGGTTTCTCGAGAAACCTGTCGAAGCAAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-334s21c1
Sequence:CCGGTACGTGGACAAAGTGTCAAACCTCGAGGTTTGACACTTTGTCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032878
VALIDATED
ALKBH6 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 6 (E. coli)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032878.2-187s1c1
Sequence:CCGGGAAGAGGAGGAGTATTTGCTTCTCGAGAAGCAAATACTCCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-196s1c1
Sequence:CCGGGAGTATTTGCTTCGACAGGTTCTCGAGAACCTGTCGAAGCAAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-364s1c1
Sequence:CCGGGCTACGTGGACAAAGTGTCAACTCGAGTTGACACTTTGTCCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-72s1c1
Sequence:CCGGGTGCAAGGAGTTGGTGTTGATCTCGAGATCAACACCAACTCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-146s21c1
Sequence:CCGGCACCACCTGTAATCTACTATGCTCGAGCATAGTAGATTACAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-386s21c1
Sequence:CCGGATGTCCTCGTGAACCAGTATCCTCGAGGATACTGGTTCACGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-197s21c1
Sequence:GTACCGGAGTATTTGCTTCGACAGGTTTCTCGAGAAACCTGTCGAAGCAAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-334s21c1
Sequence:CCGGTACGTGGACAAAGTGTCAAACCTCGAGGTTTGACACTTTGTCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032878
VALIDATED
ALKBH6 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 6 (E. coli)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032878.2-187s1c1
Sequence:CCGGGAAGAGGAGGAGTATTTGCTTCTCGAGAAGCAAATACTCCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-196s1c1
Sequence:CCGGGAGTATTTGCTTCGACAGGTTCTCGAGAACCTGTCGAAGCAAATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-364s1c1
Sequence:CCGGGCTACGTGGACAAAGTGTCAACTCGAGTTGACACTTTGTCCACGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032878.2-72s1c1
Sequence:CCGGGTGCAAGGAGTTGGTGTTGATCTCGAGATCAACACCAACTCCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-146s21c1
Sequence:CCGGCACCACCTGTAATCTACTATGCTCGAGCATAGTAGATTACAGGTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-386s21c1
Sequence:CCGGATGTCCTCGTGAACCAGTATCCTCGAGGATACTGGTTCACGAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-197s21c1
Sequence:GTACCGGAGTATTTGCTTCGACAGGTTTCTCGAGAAACCTGTCGAAGCAAATACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_032878.3-334s21c1
Sequence:CCGGTACGTGGACAAAGTGTCAAACCTCGAGGTTTGACACTTTGTCCACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks