EMAIL THIS PAGE TO A FRIEND

ALKBH7

alkB, alkylation repair homolog 7 (E. coli)

46 Gene Product Result for
Synonyms: ABH7 SPATA11 UNQ6002
UniProtKB ID: Q9BT30, B2R4U9, Q53FF3
Gene ID:
Mouse(66400) alkB, alkylation repair homolog 7 (E. coli)
Rat(679944) alkB, alkylation repair homolog 7 (E. coli)
sheep(101109968) alkB, alkylation repair homolog 7 (E. coli)
domestic guinea pig(100717778) alkB, alkylation repair homolog 7 (E. coli)
naked mole-rat(101721228) alkB, alkylation repair homolog 7 (E. coli)
Zebrafish(550272) alkB, alkylation repair homolog 7 (E. coli)
dog(611351) alkB, alkylation repair homolog 7 (E. coli)
cow(535305) alkB, alkylation repair homolog 7 (E. coli)
domestic cat(101095551) alkB, alkylation repair homolog 7 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025538 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025538 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025538 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014581 MISSION® esiRNA esiRNA targeting mouse Alkbh7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032306 Rosetta Predictions human pricing
NM_001109384 Rosetta Predictions rat pricing
NM_025538 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034885 predicted 558
2 SASI_Hs01_00034886 predicted 599
3 SASI_Hs01_00034887 predicted 556
4 SASI_Hs01_00034888 predicted 805
5 SASI_Hs01_00034889 predicted 586
6 SASI_Hs01_00034890 predicted 534
7 SASI_Hs01_00034892 predicted 639
8 SASI_Hs01_00034893 predicted 594
9 SASI_Hs01_00034894 predicted 845
10 SASI_Hs02_00359651 predicted 703
11 SASI_Hs01_00034891 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247886 predicted 548
2 SASI_Rn02_00247887 predicted 428
3 SASI_Rn02_00247888 predicted 682
4 SASI_Rn02_00247889 predicted 381
5 SASI_Rn02_00247890 predicted 554
6 SASI_Rn02_00247891 predicted 477
7 SASI_Rn02_00247892 predicted 491
8 SASI_Rn02_00247893 predicted 536
9 SASI_Rn02_00247894 predicted 444
10 SASI_Rn02_00247895 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025538 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099958 predicted 534
2 SASI_Mm01_00099959 predicted 532
3 SASI_Mm01_00099960 predicted 414
4 SASI_Mm01_00099961 predicted 365
5 SASI_Mm01_00099962 predicted 319
6 SASI_Mm01_00099963 predicted 428
7 SASI_Mm01_00099964 predicted 521
8 SASI_Mm02_00328462 predicted 417
9 SASI_Mm01_00099965 predicted 518
10 SASI_Mm01_00099966 predicted 216
11 SASI_Mm01_00099967 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032306
VALIDATED
ALKBH7 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 7 (E. coli)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-617s21c1
Sequence:CCGGGAGAAGTCGCGCTGGTCAGAACTCGAGTTCTGACCAGCGCGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-603s21c1
Sequence:CCGGGCTTCCGAGAGACAGAGAAGTCTCGAGACTTCTCTGTCTCTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-899s1c1
Sequence:CCGGGCCCGTTATGACTTCTCCCATCTCGAGATGGGAGAAGTCATAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032306.2-748s1c1
Sequence:CCGGCCACGTGGACAGCATCAAGTTCTCGAGAACTTGATGCTGTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-917s1c1
Sequence:CCGGCATGAGATCCTTCGGGATGAACTCGAGTTCATCCCGAAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-564s1c1
Sequence:CCGGGCCGCTACGAATACGATCACTCTCGAGAGTGATCGTATTCGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-929s1c1
Sequence:CCGGCGGGATGAAGAGTCCTTCTTTCTCGAGAAAGAAGGACTCTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032306
VALIDATED
ALKBH7 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 7 (E. coli)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-617s21c1
Sequence:CCGGGAGAAGTCGCGCTGGTCAGAACTCGAGTTCTGACCAGCGCGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-603s21c1
Sequence:CCGGGCTTCCGAGAGACAGAGAAGTCTCGAGACTTCTCTGTCTCTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-899s1c1
Sequence:CCGGGCCCGTTATGACTTCTCCCATCTCGAGATGGGAGAAGTCATAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032306.2-748s1c1
Sequence:CCGGCCACGTGGACAGCATCAAGTTCTCGAGAACTTGATGCTGTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-917s1c1
Sequence:CCGGCATGAGATCCTTCGGGATGAACTCGAGTTCATCCCGAAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-564s1c1
Sequence:CCGGGCCGCTACGAATACGATCACTCTCGAGAGTGATCGTATTCGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-929s1c1
Sequence:CCGGCGGGATGAAGAGTCCTTCTTTCTCGAGAAAGAAGGACTCTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032306
VALIDATED
ALKBH7 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 7 (E. coli)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-617s21c1
Sequence:CCGGGAGAAGTCGCGCTGGTCAGAACTCGAGTTCTGACCAGCGCGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032306.2-603s21c1
Sequence:CCGGGCTTCCGAGAGACAGAGAAGTCTCGAGACTTCTCTGTCTCTCGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-899s1c1
Sequence:CCGGGCCCGTTATGACTTCTCCCATCTCGAGATGGGAGAAGTCATAACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032306.2-748s1c1
Sequence:CCGGCCACGTGGACAGCATCAAGTTCTCGAGAACTTGATGCTGTCCACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-917s1c1
Sequence:CCGGCATGAGATCCTTCGGGATGAACTCGAGTTCATCCCGAAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-564s1c1
Sequence:CCGGGCCGCTACGAATACGATCACTCTCGAGAGTGATCGTATTCGTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032306.2-929s1c1
Sequence:CCGGCGGGATGAAGAGTCCTTCTTTCTCGAGAAAGAAGGACTCTTCATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025538
VALIDATED
ALKBH7 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 7 (E. coli)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025538.2-549s21c1
Sequence:CCGGCTTAGAGATGAAGAATCATTTCTCGAGAAATGATTCTTCATCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-419s21c1
Sequence:CCGGCCTGTTGTCTCCAAGTGTTATCTCGAGATAACACTTGGAGACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-596s21c1
Sequence:CCGGCCGACGCATCTCAGTGATTTGCTCGAGCAAATCACTGAGATGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-493s21c1
Sequence:CCGGCAGGGTCTCTCTATATCTTAACTCGAGTTAAGATATAGAGAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-681s21c1
Sequence:CCGGCCCACATATCCTCCATATTTGCTCGAGCAAATATGGAGGATATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-241s1c1
Sequence:CCGGGAGAAATCCTGCTGGTCTGATCTCGAGATCAGACCAGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-434s1c1
Sequence:CCGGGTGTTATGAAGCTGGTGCATACTCGAGTATGCACCAGCTTCATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025538.1-683s1c1
Sequence:CCGGCCACATATCCTCCATATTTGTCTCGAGACAAATATGGAGGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025538
VALIDATED
ALKBH7 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 7 (E. coli)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025538.2-549s21c1
Sequence:CCGGCTTAGAGATGAAGAATCATTTCTCGAGAAATGATTCTTCATCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-419s21c1
Sequence:CCGGCCTGTTGTCTCCAAGTGTTATCTCGAGATAACACTTGGAGACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-596s21c1
Sequence:CCGGCCGACGCATCTCAGTGATTTGCTCGAGCAAATCACTGAGATGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-493s21c1
Sequence:CCGGCAGGGTCTCTCTATATCTTAACTCGAGTTAAGATATAGAGAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-681s21c1
Sequence:CCGGCCCACATATCCTCCATATTTGCTCGAGCAAATATGGAGGATATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-241s1c1
Sequence:CCGGGAGAAATCCTGCTGGTCTGATCTCGAGATCAGACCAGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-434s1c1
Sequence:CCGGGTGTTATGAAGCTGGTGCATACTCGAGTATGCACCAGCTTCATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025538.1-683s1c1
Sequence:CCGGCCACATATCCTCCATATTTGTCTCGAGACAAATATGGAGGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025538
VALIDATED
ALKBH7 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 7 (E. coli)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025538.2-549s21c1
Sequence:CCGGCTTAGAGATGAAGAATCATTTCTCGAGAAATGATTCTTCATCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-419s21c1
Sequence:CCGGCCTGTTGTCTCCAAGTGTTATCTCGAGATAACACTTGGAGACAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-596s21c1
Sequence:CCGGCCGACGCATCTCAGTGATTTGCTCGAGCAAATCACTGAGATGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-493s21c1
Sequence:CCGGCAGGGTCTCTCTATATCTTAACTCGAGTTAAGATATAGAGAGACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246688    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025538.2-681s21c1
Sequence:CCGGCCCACATATCCTCCATATTTGCTCGAGCAAATATGGAGGATATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-241s1c1
Sequence:CCGGGAGAAATCCTGCTGGTCTGATCTCGAGATCAGACCAGCAGGATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025538.1-434s1c1
Sequence:CCGGGTGTTATGAAGCTGGTGCATACTCGAGTATGCACCAGCTTCATAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025538.1-683s1c1
Sequence:CCGGCCACATATCCTCCATATTTGTCTCGAGACAAATATGGAGGATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks