EMAIL THIS PAGE TO A FRIEND

ALKBH8

alkB, alkylation repair homolog 8 (E. coli)

83 Gene Product Result for
Synonyms: ABH8
UniProtKB ID: Q96BT7, B1Q2M0, B4DEF6, Q8N989
Gene ID:
Mouse(67667) alkB, alkylation repair homolog 8 (E. coli)
Rat(366783) alkB, alkylation repair homolog 8 (E. coli)
Zebrafish(556362) alkB, alkylation repair homolog 8 (E. coli)
chicken(418972) alkB, alkylation repair homolog 8 (E. coli)
cow(781788) alkB, alkylation repair homolog 8 (E. coli)
domestic cat(101099745) alkB, alkylation repair homolog 8 (E. coli)
dog(489424) alkB, alkylation repair homolog 8 (E. coli)
naked mole-rat(101705703) alkB, alkylation repair homolog 8 (E. coli)
domestic guinea pig(100714624) alkB, alkylation repair homolog 8 (E. coli)
sheep(101104088) alkB, alkylation repair homolog 8 (E. coli)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138775 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138775 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138775 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138775 Rosetta Predictions human pricing
XM_001055538 Rosetta Predictions rat pricing
XM_345766 Rosetta Predictions rat pricing
NM_026303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153516 predicted 616
2 SASI_Hs02_00363895 predicted 320
3 SASI_Hs02_00363896 predicted 315
4 SASI_Hs01_00153518 predicted 214
5 SASI_Hs01_00153519 predicted 335
6 SASI_Hs01_00153520 predicted 200
7 SASI_Hs01_00153521 predicted 369
8 SASI_Hs01_00153522 predicted 563
9 SASI_Hs01_00153523 predicted 663
10 SASI_Hs01_00153524 predicted 262
11 SASI_Hs01_00153515 predicted 491
12 SASI_Hs01_00153517 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279934 predicted 1276
2 SASI_Rn02_00279935 predicted 646
3 SASI_Rn02_00279936 predicted 1308
4 SASI_Rn02_00279937 predicted 958
5 SASI_Rn02_00279938 predicted 259
6 SASI_Rn02_00279939 predicted 716
7 SASI_Rn02_00279940 predicted 622
8 SASI_Rn02_00279941 predicted 816
9 SASI_Rn02_00279942 predicted 1679
10 SASI_Rn02_00279943 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398660 predicted 251
2 SASI_Rn02_00398661 predicted 297
3 SASI_Rn02_00398662 predicted 306
4 SASI_Rn02_00398663 predicted 347
5 SASI_Rn02_00398664 predicted 262
6 SASI_Rn02_00398665 predicted 298
7 SASI_Rn02_00398666 predicted 408
8 SASI_Rn02_00398667 predicted 271
9 SASI_Rn02_00398668 predicted 244
10 SASI_Rn02_00398669 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163265 predicted 260
2 SASI_Mm01_00163267 predicted 1684
3 SASI_Mm01_00163268 predicted 658
4 SASI_Mm01_00163269 predicted 828
5 SASI_Mm01_00163270 predicted 968
6 SASI_Mm01_00163271 predicted 724
7 SASI_Mm01_00163272 predicted 1285
8 SASI_Mm01_00163273 predicted 1611
9 SASI_Mm01_00163274 predicted 1303
10 SASI_Mm02_00330002 predicted 971
11 SASI_Mm01_00163266 predicted 1714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138775
VALIDATED
ALKBH8 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 8 (E. coli)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138775.1-347s1c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-977s1c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-378s1c1
Sequence:CCGGGAAGAATCTAAGAGAGCCTATCTCGAGATAGGCTCTCTTAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-1304s1c1
Sequence:CCGGCGCATTAATGACTCTCAGGAACTCGAGTTCCTGAGAGTCATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-249s1c1
Sequence:CCGGGCCAATGGTGGTTTGGGTAATCTCGAGATTACCCAAACCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138775.1-567s1c1
Sequence:CCGGGAAAGTGTTGATTGGACAGAACTCGAGTTCTGTCCAATCAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1625s21c1
Sequence:CCGGCAGGTGGGAAGGCACTCATTTCTCGAGAAATGAGTGCCTTCCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-2141s21c1
Sequence:CCGGTTACCTGAACACATCATATATCTCGAGATATATGATGTGTTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-1405s21c1
Sequence:CCGGGGCATCAATAAGGAGTTATATCTCGAGATATAACTCCTTATTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1082s21c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-381s21c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138775
VALIDATED
ALKBH8 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 8 (E. coli)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138775.1-347s1c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-977s1c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-378s1c1
Sequence:CCGGGAAGAATCTAAGAGAGCCTATCTCGAGATAGGCTCTCTTAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-1304s1c1
Sequence:CCGGCGCATTAATGACTCTCAGGAACTCGAGTTCCTGAGAGTCATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-249s1c1
Sequence:CCGGGCCAATGGTGGTTTGGGTAATCTCGAGATTACCCAAACCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138775.1-567s1c1
Sequence:CCGGGAAAGTGTTGATTGGACAGAACTCGAGTTCTGTCCAATCAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1625s21c1
Sequence:CCGGCAGGTGGGAAGGCACTCATTTCTCGAGAAATGAGTGCCTTCCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-2141s21c1
Sequence:CCGGTTACCTGAACACATCATATATCTCGAGATATATGATGTGTTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-1405s21c1
Sequence:CCGGGGCATCAATAAGGAGTTATATCTCGAGATATAACTCCTTATTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1082s21c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-381s21c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138775
VALIDATED
ALKBH8 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 8 (E. coli)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_138775.1-347s1c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-977s1c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-378s1c1
Sequence:CCGGGAAGAATCTAAGAGAGCCTATCTCGAGATAGGCTCTCTTAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138775.1-1304s1c1
Sequence:CCGGCGCATTAATGACTCTCAGGAACTCGAGTTCCTGAGAGTCATTAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138775.1-249s1c1
Sequence:CCGGGCCAATGGTGGTTTGGGTAATCTCGAGATTACCCAAACCACCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138775.1-567s1c1
Sequence:CCGGGAAAGTGTTGATTGGACAGAACTCGAGTTCTGTCCAATCAACACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1625s21c1
Sequence:CCGGCAGGTGGGAAGGCACTCATTTCTCGAGAAATGAGTGCCTTCCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-2141s21c1
Sequence:CCGGTTACCTGAACACATCATATATCTCGAGATATATGATGTGTTCAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-1405s21c1
Sequence:CCGGGGCATCAATAAGGAGTTATATCTCGAGATATAACTCCTTATTGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_138775.2-1082s21c1
Sequence:CCGGCCAGTGATGTTGGAGACTTAACTCGAGTTAAGTCTCCAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138775.2-381s21c1
Sequence:CCGGGCCGTACTCATTTGCAAGATACTCGAGTATCTTGCAAATGAGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026303
VALIDATED
ALKBH8 MISSION shRNA Bacterial Glycerol Stock
alkB, alkylation repair homolog 8 (E. coli)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-2124s1c1
Sequence:CCGGCAGAGATACTTAGGAAACATTCTCGAGAATGTTTCCTAAGTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026303.1-1523s1c1
Sequence:CCGGCCCTCATTTATGTCTGGGCAACTCGAGTTGCCCAGACATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-1976s1c1
Sequence:CCGGGCTATTACGATCAAGGGAATTCTCGAGAATTCCCTTGATCGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-628s1c1
Sequence:CCGGCCTGAGGTTTGCAGTAGCATTCTCGAGAATGCTACTGCAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-688s1c1
Sequence:CCGGCCAGACCAGTTGACCATAAATCTCGAGATTTATGGTCAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026303
VALIDATED
ALKBH8 MISSION shRNA shRNA Plasmid DNA
alkB, alkylation repair homolog 8 (E. coli)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-2124s1c1
Sequence:CCGGCAGAGATACTTAGGAAACATTCTCGAGAATGTTTCCTAAGTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026303.1-1523s1c1
Sequence:CCGGCCCTCATTTATGTCTGGGCAACTCGAGTTGCCCAGACATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-1976s1c1
Sequence:CCGGGCTATTACGATCAAGGGAATTCTCGAGAATTCCCTTGATCGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-628s1c1
Sequence:CCGGCCTGAGGTTTGCAGTAGCATTCTCGAGAATGCTACTGCAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-688s1c1
Sequence:CCGGCCAGACCAGTTGACCATAAATCTCGAGATTTATGGTCAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026303
VALIDATED
ALKBH8 MISSION shRNA Lentiviral Transduction Particles
alkB, alkylation repair homolog 8 (E. coli)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127074    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-2124s1c1
Sequence:CCGGCAGAGATACTTAGGAAACATTCTCGAGAATGTTTCCTAAGTATCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026303.1-1523s1c1
Sequence:CCGGCCCTCATTTATGTCTGGGCAACTCGAGTTGCCCAGACATAAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-1976s1c1
Sequence:CCGGGCTATTACGATCAAGGGAATTCTCGAGAATTCCCTTGATCGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-628s1c1
Sequence:CCGGCCTGAGGTTTGCAGTAGCATTCTCGAGAATGCTACTGCAAACCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026303.1-688s1c1
Sequence:CCGGCCAGACCAGTTGACCATAAATCTCGAGATTTATGGTCAACTGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks