EMAIL THIS PAGE TO A FRIEND

ALLC

allantoicase

Synonyms: ALC
UniProtKB ID: Q8N6M5, Q53T95, Q5RL81, Q96RE6, Q9NZA7
Gene ID:
Human(55821) Summary: Allantoicase (EC 3.5.3.4) participates in the uric acid degradation pathway. Its enzymatic activity, like that of urate oxidase (MIM 191540), was lost during vertebrate evolution.[supplied by OMIM, Nov 2008]
Mouse(94041) allantoicase
Rat(246758) allantoicase
Zebrafish(436989) allantoicase
dog(475651) allantoicase
Horse(100072815) allantoicase
cow(528311) allantoicase
sheep(101121064) allantoicase
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018436 Rosetta Predictions human pricing
NM_199232 Rosetta Predictions human pricing
NM_001013037 Rosetta Predictions rat pricing
NM_053156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017214 predicted 683
2 SASI_Hs01_00017215 predicted 639
3 SASI_Hs01_00017216 predicted 634
4 SASI_Hs02_00351963 predicted 676
5 SASI_Hs01_00017217 predicted 1144
6 SASI_Hs01_00017218 predicted 790
7 SASI_Hs01_00017221 predicted 1130
8 SASI_Hs01_00017222 predicted 1009
9 SASI_Hs01_00017223 predicted 734
10 SASI_Hs02_00351964 predicted 1151
11 SASI_Hs01_00017219 predicted 961
12 SASI_Hs01_00017220 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134957 predicted 1384
2 SASI_Hs01_00134958 predicted 1356
3 SASI_Hs01_00134959 predicted 1372
4 SASI_Hs01_00134960 predicted 1576
5 SASI_Hs01_00134961 predicted 1600
6 SASI_Hs01_00134962 predicted 1600
7 SASI_Hs01_00134963 predicted 1408
8 SASI_Hs01_00134964 predicted 1463
9 SASI_Hs01_00134965 predicted 1555
10 SASI_Hs01_00134966 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040257 predicted 456
2 SASI_Rn01_00040258 predicted 240
3 SASI_Rn02_00200629 predicted 1011
4 SASI_Rn01_00040260 predicted 417
5 SASI_Rn01_00040261 predicted 560
6 SASI_Rn01_00040262 predicted 320
7 SASI_Rn01_00040263 predicted 895
8 SASI_Rn01_00040264 predicted 1046
9 SASI_Rn01_00040266 predicted 838
10 SASI_Rn02_00200630 predicted 431
11 SASI_Rn01_00040259 predicted 1148
12 SASI_Rn01_00040265 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106837 predicted 770
2 SASI_Mm01_00106838 predicted 837
3 SASI_Mm01_00106840 predicted 1096
4 SASI_Mm02_00337679 predicted 1025
5 SASI_Mm01_00106841 predicted 298
6 SASI_Mm02_00337680 predicted 684
7 SASI_Mm01_00106843 predicted 353
8 SASI_Mm01_00106844 predicted 826
9 SASI_Mm01_00106845 predicted 1127
10 SASI_Mm01_00106846 predicted 1163
11 SASI_Mm01_00106839 predicted 937
12 SASI_Mm01_00106842 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018436
ALLC MISSION shRNA Bacterial Glycerol Stock
allantoicase
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018436.3-805s21c1
Sequence:CCGGTTGGGCACCCAAACAATATAACTCGAGTTATATTGTTTGGGTGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-1105s1c1
Sequence:CCGGCCAAGTTGTCTCCCAACCAAACTCGAGTTTGGTTGGGAGACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-620s1c1
Sequence:CCGGGACTCATATCAGACTCAACATCTCGAGATGTTGAGTCTGATATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-231s1c1
Sequence:CCGGCCGTGCTTCAAAGAGCATGAACTCGAGTTCATGCTCTTTGAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-372s1c1
Sequence:CCGGGTTTCTTACTTCACGGGAGATCTCGAGATCTCCCGTGAAGTAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-942s1c1
Sequence:CCGGCCTGGAGTAATAACTCGAATTCTCGAGAATTCGAGTTATTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018436
ALLC MISSION shRNA shRNA Plasmid DNA
allantoicase
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018436.3-805s21c1
Sequence:CCGGTTGGGCACCCAAACAATATAACTCGAGTTATATTGTTTGGGTGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-1105s1c1
Sequence:CCGGCCAAGTTGTCTCCCAACCAAACTCGAGTTTGGTTGGGAGACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-620s1c1
Sequence:CCGGGACTCATATCAGACTCAACATCTCGAGATGTTGAGTCTGATATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-231s1c1
Sequence:CCGGCCGTGCTTCAAAGAGCATGAACTCGAGTTCATGCTCTTTGAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-372s1c1
Sequence:CCGGGTTTCTTACTTCACGGGAGATCTCGAGATCTCCCGTGAAGTAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-942s1c1
Sequence:CCGGCCTGGAGTAATAACTCGAATTCTCGAGAATTCGAGTTATTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018436
ALLC MISSION shRNA Lentiviral Transduction Particles
allantoicase
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018436.3-805s21c1
Sequence:CCGGTTGGGCACCCAAACAATATAACTCGAGTTATATTGTTTGGGTGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-1105s1c1
Sequence:CCGGCCAAGTTGTCTCCCAACCAAACTCGAGTTTGGTTGGGAGACAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-620s1c1
Sequence:CCGGGACTCATATCAGACTCAACATCTCGAGATGTTGAGTCTGATATGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-231s1c1
Sequence:CCGGCCGTGCTTCAAAGAGCATGAACTCGAGTTCATGCTCTTTGAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-372s1c1
Sequence:CCGGGTTTCTTACTTCACGGGAGATCTCGAGATCTCCCGTGAAGTAAGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018436.2-942s1c1
Sequence:CCGGCCTGGAGTAATAACTCGAATTCTCGAGAATTCGAGTTATTACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053156
ALLC MISSION shRNA Bacterial Glycerol Stock
allantoicase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-1160s1c1
Sequence:CCGGGCTTCCAGTCACCAAGCTAATCTCGAGATTAGCTTGGTGACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-485s1c1
Sequence:CCGGCCTGAGTGAAGAAGATACAATCTCGAGATTGTATCTTCTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-880s1c1
Sequence:CCGGCCAAGTCCATAGCAGATGGTTCTCGAGAACCATCTGCTATGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-837s1c1
Sequence:CCGGGCACACTTTGGACATCCAAATCTCGAGATTTGGATGTCCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-422s1c1
Sequence:CCGGCGACGTGGACATTTCTTACTTCTCGAGAAGTAAGAAATGTCCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053156
ALLC MISSION shRNA shRNA Plasmid DNA
allantoicase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-1160s1c1
Sequence:CCGGGCTTCCAGTCACCAAGCTAATCTCGAGATTAGCTTGGTGACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-485s1c1
Sequence:CCGGCCTGAGTGAAGAAGATACAATCTCGAGATTGTATCTTCTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-880s1c1
Sequence:CCGGCCAAGTCCATAGCAGATGGTTCTCGAGAACCATCTGCTATGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-837s1c1
Sequence:CCGGGCACACTTTGGACATCCAAATCTCGAGATTTGGATGTCCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-422s1c1
Sequence:CCGGCGACGTGGACATTTCTTACTTCTCGAGAAGTAAGAAATGTCCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053156
ALLC MISSION shRNA Lentiviral Transduction Particles
allantoicase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-1160s1c1
Sequence:CCGGGCTTCCAGTCACCAAGCTAATCTCGAGATTAGCTTGGTGACTGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-485s1c1
Sequence:CCGGCCTGAGTGAAGAAGATACAATCTCGAGATTGTATCTTCTTCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-880s1c1
Sequence:CCGGCCAAGTCCATAGCAGATGGTTCTCGAGAACCATCTGCTATGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-837s1c1
Sequence:CCGGGCACACTTTGGACATCCAAATCTCGAGATTTGGATGTCCAAAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053156.1-422s1c1
Sequence:CCGGCGACGTGGACATTTCTTACTTCTCGAGAAGTAAGAAATGTCCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks