EMAIL THIS PAGE TO A FRIEND

ALMS1

Alstrom syndrome 1

Synonyms: ALSS
UniProtKB ID: Q8TCU4, Q53S05, Q580Q8, Q86VP9, Q9Y4G4
Gene ID:
Human(7840) Summary: This gene encodes a protein containing a large tandem-repeat domain. The mouse ortholog of this gene has been shown to function in ciliogenesis in inner medullary collecting duct cells. Mutations in this gene have been associated with Alstrom syndrome. Alternative splice variants have been described but their full length sequences have not been determined.[provided by RefSeq, Mar 2009]
Mouse(236266) Alstrom syndrome 1
Rat(297408) Alstrom syndrome 1
chicken(422949) Alstrom syndrome 1
cow(533055) Alstrom syndrome 1
Horse(100058956) Alstrom syndrome 1
domestic cat(101098372) Alstrom syndrome 1
dog(475795) Alstrom syndrome 1
naked mole-rat(101704554) Alstrom syndrome 1
domestic guinea pig(100715509) Alstrom syndrome 1
sheep(101104651) Alstrom syndrome 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015120 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015120 Rosetta Predictions human pricing
NM_001106604 Rosetta Predictions rat pricing
NM_145223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347020 predicted 4933
2 SASI_Hs01_00216873 predicted 436
3 SASI_Hs01_00216874 predicted 1452
4 SASI_Hs01_00216876 predicted 5925
5 SASI_Hs01_00216878 predicted 2725
6 SASI_Hs02_00347021 predicted 2377
7 SASI_Hs02_00347022 predicted 5296
8 SASI_Hs01_00216881 predicted 4799
9 SASI_Hs02_00347023 predicted 7328
10 SASI_Hs01_00216882 predicted 9803
11 SASI_Hs01_00216875 predicted 3030
12 SASI_Hs01_00216877 predicted 4791
13 SASI_Hs01_00216879 predicted 7680
14 SASI_Hs01_00216880 predicted 2017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220588 predicted 1012
2 SASI_Rn02_00220589 predicted 1283
3 SASI_Rn02_00220590 predicted 7307
4 SASI_Rn02_00220591 predicted 560
5 SASI_Rn02_00220592 predicted 1581
6 SASI_Rn02_00220593 predicted 6817
7 SASI_Rn02_00220594 predicted 5120
8 SASI_Rn02_00220595 predicted 1108
9 SASI_Rn02_00220596 predicted 4201
10 SASI_Rn02_00220597 predicted 4180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074709 predicted 6274
2 SASI_Mm01_00074710 predicted 7296
3 SASI_Mm01_00074711 predicted 1927
4 SASI_Mm01_00074712 predicted 6832
5 SASI_Mm01_00074713 predicted 1512
6 SASI_Mm01_00074714 predicted 8524
7 SASI_Mm01_00074716 predicted 8945
8 SASI_Mm01_00074717 predicted 8742
9 SASI_Mm02_00340601 predicted 3077
10 SASI_Mm02_00340602 predicted 2523
11 SASI_Mm01_00074715 predicted 4480
12 SASI_Mm01_00074718 predicted 4155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015120
ALMS1 MISSION shRNA Bacterial Glycerol Stock
Alstrom syndrome 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015120.2-12752s1c1
Sequence:CCGGGTCTGGAACAAAGTGGTGATTCTCGAGAATCACCACTTTGTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9337s1c1
Sequence:CCGGGCGAGGATGAATAGTGAGTTTCTCGAGAAACTCACTATTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-2960s1c1
Sequence:CCGGCCTCTAATTCTCACTCACATACTCGAGTATGTGAGTGAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9338s1c1
Sequence:CCGGCGAGGATGAATAGTGAGTTTACTCGAGTAAACTCACTATTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-7034s1c1
Sequence:CCGGCGGGTGTATCTAATGGTGATTCTCGAGAATCACCATTAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-4722s21c1
Sequence:CCGGGGCATTGCTAGGTAGTCAAATCTCGAGATTTGACTACCTAGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12666s21c1
Sequence:CCGGCCTAGAGAAGCAGAATCCTTACTCGAGTAAGGATTCTGCTTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-997s21c1
Sequence:CCGGGTATCTCAGCACCCGCTTATACTCGAGTATAAGCGGGTGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12690s21c1
Sequence:CCGGTTGTGAGTCTGGTTGAATAAACTCGAGTTTATTCAACCAGACTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-7119s21c1
Sequence:CCGGTATTGGCACACAGACGAATTTCTCGAGAAATTCGTCTGTGTGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015120
ALMS1 MISSION shRNA shRNA Plasmid DNA
Alstrom syndrome 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015120.2-12752s1c1
Sequence:CCGGGTCTGGAACAAAGTGGTGATTCTCGAGAATCACCACTTTGTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9337s1c1
Sequence:CCGGGCGAGGATGAATAGTGAGTTTCTCGAGAAACTCACTATTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-2960s1c1
Sequence:CCGGCCTCTAATTCTCACTCACATACTCGAGTATGTGAGTGAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9338s1c1
Sequence:CCGGCGAGGATGAATAGTGAGTTTACTCGAGTAAACTCACTATTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-7034s1c1
Sequence:CCGGCGGGTGTATCTAATGGTGATTCTCGAGAATCACCATTAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-4722s21c1
Sequence:CCGGGGCATTGCTAGGTAGTCAAATCTCGAGATTTGACTACCTAGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12666s21c1
Sequence:CCGGCCTAGAGAAGCAGAATCCTTACTCGAGTAAGGATTCTGCTTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-997s21c1
Sequence:CCGGGTATCTCAGCACCCGCTTATACTCGAGTATAAGCGGGTGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12690s21c1
Sequence:CCGGTTGTGAGTCTGGTTGAATAAACTCGAGTTTATTCAACCAGACTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-7119s21c1
Sequence:CCGGTATTGGCACACAGACGAATTTCTCGAGAAATTCGTCTGTGTGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015120
ALMS1 MISSION shRNA Lentiviral Transduction Particles
Alstrom syndrome 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015120.2-12752s1c1
Sequence:CCGGGTCTGGAACAAAGTGGTGATTCTCGAGAATCACCACTTTGTTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9337s1c1
Sequence:CCGGGCGAGGATGAATAGTGAGTTTCTCGAGAAACTCACTATTCATCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-2960s1c1
Sequence:CCGGCCTCTAATTCTCACTCACATACTCGAGTATGTGAGTGAGAATTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-9338s1c1
Sequence:CCGGCGAGGATGAATAGTGAGTTTACTCGAGTAAACTCACTATTCATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015120.2-7034s1c1
Sequence:CCGGCGGGTGTATCTAATGGTGATTCTCGAGAATCACCATTAGATACACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-4722s21c1
Sequence:CCGGGGCATTGCTAGGTAGTCAAATCTCGAGATTTGACTACCTAGCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12666s21c1
Sequence:CCGGCCTAGAGAAGCAGAATCCTTACTCGAGTAAGGATTCTGCTTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-997s21c1
Sequence:CCGGGTATCTCAGCACCCGCTTATACTCGAGTATAAGCGGGTGCTGAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015120.4-12690s21c1
Sequence:CCGGTTGTGAGTCTGGTTGAATAAACTCGAGTTTATTCAACCAGACTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015120.4-7119s21c1
Sequence:CCGGTATTGGCACACAGACGAATTTCTCGAGAAATTCGTCTGTGTGCCAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145223
ALMS1 MISSION shRNA Bacterial Glycerol Stock
Alstrom syndrome 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-7746s1c1
Sequence:CCGGCCAGACACTAAATCCATTAAACTCGAGTTTAATGGATTTAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6112s1c1
Sequence:CCGGGCCAGGACAAACTAACTTCTACTCGAGTAGAAGTTAGTTTGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-4999s1c1
Sequence:CCGGGCTATGGTAGTACAGATTCATCTCGAGATGAATCTGTACTACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6046s1c1
Sequence:CCGGCCAATGTCAGTACAAATGTTACTCGAGTAACATTTGTACTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145223
ALMS1 MISSION shRNA shRNA Plasmid DNA
Alstrom syndrome 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-7746s1c1
Sequence:CCGGCCAGACACTAAATCCATTAAACTCGAGTTTAATGGATTTAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6112s1c1
Sequence:CCGGGCCAGGACAAACTAACTTCTACTCGAGTAGAAGTTAGTTTGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-4999s1c1
Sequence:CCGGGCTATGGTAGTACAGATTCATCTCGAGATGAATCTGTACTACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6046s1c1
Sequence:CCGGCCAATGTCAGTACAAATGTTACTCGAGTAACATTTGTACTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145223
ALMS1 MISSION shRNA Lentiviral Transduction Particles
Alstrom syndrome 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-7746s1c1
Sequence:CCGGCCAGACACTAAATCCATTAAACTCGAGTTTAATGGATTTAGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6112s1c1
Sequence:CCGGGCCAGGACAAACTAACTTCTACTCGAGTAGAAGTTAGTTTGTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-4999s1c1
Sequence:CCGGGCTATGGTAGTACAGATTCATCTCGAGATGAATCTGTACTACCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145223.1-6046s1c1
Sequence:CCGGCCAATGTCAGTACAAATGTTACTCGAGTAACATTTGTACTGACATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks