EMAIL THIS PAGE TO A FRIEND

ALMS1P

Alstrom syndrome 1 pseudogene

24 Gene Product Result for
Synonyms: ALMS1L
Species: Human ALMS1P(200420)
UniProtKB ID: Q96L16
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145300 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127071 MISSION® esiRNA esiRNA human ALMS1P (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145300 Rosetta Predictions human pricing
NR_003683 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057687 predicted 582
2 SASI_Hs01_00057688 predicted 759
3 SASI_Hs01_00057689 predicted 714
4 SASI_Hs01_00057690 predicted 770
5 SASI_Hs01_00057691 predicted 696
6 SASI_Hs01_00057692 predicted 772
7 SASI_Hs01_00057693 predicted 860
8 SASI_Hs01_00057694 predicted 575
9 SASI_Hs01_00057695 predicted 1140
10 SASI_Hs01_00057696 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380149 predicted 1196
2 SASI_Hs02_00380150 predicted 1199
3 SASI_Hs02_00380151 predicted 1183
4 SASI_Hs02_00380152 predicted 1343
5 SASI_Hs02_00380153 predicted 1054
6 SASI_Hs02_00380154 predicted 1071
7 SASI_Hs02_00380155 predicted 648
8 SASI_Hs02_00380156 predicted 646
9 SASI_Hs02_00380157 predicted 389
10 SASI_Hs02_00380158 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145300
ALMS1P MISSION shRNA Bacterial Glycerol Stock
Alstrom syndrome 1 pseudogene
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-963s1c1
Sequence:CCGGGAAATGATTCAGAGGTCCAAACTCGAGTTTGGACCTCTGAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145300.1-1426s1c1
Sequence:CCGGCCACTGAACTGTACACGTTAACTCGAGTTAACGTGTACAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-1047s1c1
Sequence:CCGGCTTCCAGGGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-705s1c1
Sequence:CCGGCCACTGAAGCTGTTTGTGAGACTCGAGTCTCACAAACAGCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-994s1c1
Sequence:CCGGCAGGAGGAACAGTAGCACAAACTCGAGTTTGTGCTACTGTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-732s1c1
Sequence:CCGGCTGCAGGAATCGCTTCAGTTTCTCGAGAAACTGAAGCGATTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-773s1c1
Sequence:CCGGCCACATTTGGGAGCGGATAAACTCGAGTTTATCCGCTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-827s1c1
Sequence:CCGGGCAGAGCATGTTAAAGAGCGACTCGAGTCGCTCTTTAACATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-785s1c1
Sequence:CCGGGCGGATAAAGCGTCTGAAGTTCTCGAGAACTTCAGACGCTTTATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-786s1c1
Sequence:CCGGCGGATAAAGCGTCTGAAGTTACTCGAGTAACTTCAGACGCTTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-947s1c1
Sequence:CCGGGCCTATCAGCAAGAAGGAAATCTCGAGATTTCCTTCTTGCTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-759s1c1
Sequence:CCGGCCTGACTTCATCTCCCACATTCTCGAGAATGTGGGAGATGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145300.1-1264s1c1
Sequence:CCGGGCAAGTTCGTAGAGACAGAATCTCGAGATTCTGTCTCTACGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145300
ALMS1P MISSION shRNA shRNA Plasmid DNA
Alstrom syndrome 1 pseudogene
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-963s1c1
Sequence:CCGGGAAATGATTCAGAGGTCCAAACTCGAGTTTGGACCTCTGAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145300.1-1426s1c1
Sequence:CCGGCCACTGAACTGTACACGTTAACTCGAGTTAACGTGTACAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-1047s1c1
Sequence:CCGGCTTCCAGGGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-705s1c1
Sequence:CCGGCCACTGAAGCTGTTTGTGAGACTCGAGTCTCACAAACAGCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-994s1c1
Sequence:CCGGCAGGAGGAACAGTAGCACAAACTCGAGTTTGTGCTACTGTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-732s1c1
Sequence:CCGGCTGCAGGAATCGCTTCAGTTTCTCGAGAAACTGAAGCGATTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-773s1c1
Sequence:CCGGCCACATTTGGGAGCGGATAAACTCGAGTTTATCCGCTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-827s1c1
Sequence:CCGGGCAGAGCATGTTAAAGAGCGACTCGAGTCGCTCTTTAACATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-785s1c1
Sequence:CCGGGCGGATAAAGCGTCTGAAGTTCTCGAGAACTTCAGACGCTTTATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-786s1c1
Sequence:CCGGCGGATAAAGCGTCTGAAGTTACTCGAGTAACTTCAGACGCTTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-947s1c1
Sequence:CCGGGCCTATCAGCAAGAAGGAAATCTCGAGATTTCCTTCTTGCTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-759s1c1
Sequence:CCGGCCTGACTTCATCTCCCACATTCTCGAGAATGTGGGAGATGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145300.1-1264s1c1
Sequence:CCGGGCAAGTTCGTAGAGACAGAATCTCGAGATTCTGTCTCTACGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145300
ALMS1P MISSION shRNA Lentiviral Transduction Particles
Alstrom syndrome 1 pseudogene
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-963s1c1
Sequence:CCGGGAAATGATTCAGAGGTCCAAACTCGAGTTTGGACCTCTGAATCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143916    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145300.1-1426s1c1
Sequence:CCGGCCACTGAACTGTACACGTTAACTCGAGTTAACGTGTACAGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-1047s1c1
Sequence:CCGGCTTCCAGGGAAAGGAGAGAAACTCGAGTTTCTCTCCTTTCCCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-705s1c1
Sequence:CCGGCCACTGAAGCTGTTTGTGAGACTCGAGTCTCACAAACAGCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-994s1c1
Sequence:CCGGCAGGAGGAACAGTAGCACAAACTCGAGTTTGTGCTACTGTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-732s1c1
Sequence:CCGGCTGCAGGAATCGCTTCAGTTTCTCGAGAAACTGAAGCGATTCCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-773s1c1
Sequence:CCGGCCACATTTGGGAGCGGATAAACTCGAGTTTATCCGCTCCCAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-827s1c1
Sequence:CCGGGCAGAGCATGTTAAAGAGCGACTCGAGTCGCTCTTTAACATGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-785s1c1
Sequence:CCGGGCGGATAAAGCGTCTGAAGTTCTCGAGAACTTCAGACGCTTTATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145300.1-786s1c1
Sequence:CCGGCGGATAAAGCGTCTGAAGTTACTCGAGTAACTTCAGACGCTTTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-947s1c1
Sequence:CCGGGCCTATCAGCAAGAAGGAAATCTCGAGATTTCCTTCTTGCTGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145300.1-759s1c1
Sequence:CCGGCCTGACTTCATCTCCCACATTCTCGAGAATGTGGGAGATGAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145300.1-1264s1c1
Sequence:CCGGGCAAGTTCGTAGAGACAGAATCTCGAGATTCTGTCTCTACGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks