EMAIL THIS PAGE TO A FRIEND

ALOX12

arachidonate 12-lipoxygenase

89 Gene Product Result for
Synonyms: 12-LOX 12S-LOX LOG12
UniProtKB ID: P18054, O95569, Q6ISF8, Q9UQM4
Gene ID:
Mouse(11684) arachidonate 12-lipoxygenase
Rat(287454) arachidonate 12-lipoxygenase
Zebrafish(322732) arachidonate 12-lipoxygenase
cow(407169) arachidonate 12-lipoxygenase
Horse(100072916) arachidonate 12-lipoxygenase
domestic cat(101094304) arachidonate 12-lipoxygenase
dog(479476) arachidonate 12-lipoxygenase
naked mole-rat(101702123) arachidonate 12-lipoxygenase
domestic guinea pig(100719400) arachidonate 12-lipoxygenase
sheep(101113685) arachidonate 12-lipoxygenase
Domestic Rabbit(100271999) arachidonate 12-lipoxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000697 Rosetta Predictions human pricing
NM_001105798 Rosetta Predictions rat pricing
NM_007440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303100 predicted 1115
2 SASI_Hs02_00303101 predicted 404
3 SASI_Hs01_00063163 predicted 722
4 SASI_Hs01_00063164 predicted 524
5 SASI_Hs01_00063165 predicted 1904
6 SASI_Hs01_00063166 predicted 453
7 SASI_Hs01_00063167 predicted 522
8 SASI_Hs01_00063169 predicted 1071
9 SASI_Hs01_00063171 predicted 1073
10 SASI_Hs01_00063172 predicted 1911
11 SASI_Hs01_00063168 predicted 1804
12 SASI_Hs01_00063170 predicted 1075
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212636 predicted 1186
2 SASI_Rn02_00212637 predicted 1112
3 SASI_Rn02_00212638 predicted 1023
4 SASI_Rn02_00212639 predicted 1704
5 SASI_Rn02_00212640 predicted 1074
6 SASI_Rn02_00212641 predicted 1279
7 SASI_Rn02_00212642 predicted 1107
8 SASI_Rn02_00212643 predicted 903
9 SASI_Rn02_00212644 predicted 2006
10 SASI_Rn02_00212645 predicted 1900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311601 predicted 1946
2 SASI_Mm02_00311602 predicted 650
3 SASI_Mm02_00311603 predicted 1443
4 SASI_Mm02_00311604 predicted 578
5 SASI_Mm02_00311605 predicted 418
6 SASI_Mm02_00311606 predicted 1712
7 SASI_Mm02_00311607 predicted 1283
8 SASI_Mm02_00311608 predicted 1726
9 SASI_Mm02_00311609 predicted 1128
10 SASI_Mm02_00311610 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000697
ALOX12 MISSION shRNA Bacterial Glycerol Stock
arachidonate 12-lipoxygenase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-411s1c1
Sequence:CCGGGCATCGAGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-859s1c1
Sequence:CCGGGCTGACTTCATCCTTCTGGATCTCGAGATCCAGAAGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1482s1c1
Sequence:CCGGCCAAAGGGATGACATAGTGAACTCGAGTTCACTATGTCATCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-514s1c1
Sequence:CCGGCCTCCAAATATGAGATTCCATCTCGAGATGGAATCTCATATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1891s1c1
Sequence:CCGGCCCAAAGCTGTGCTAAACCAACTCGAGTTGGTTTAGCACAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-605s21c1
Sequence:CCGGGATGGCCCTCAAACGTGTTTACTCGAGTAAACACGTTTGAGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-1701s21c1
Sequence:CCGGTGGTATGCCTGGGTCCCTAATCTCGAGATTAGGGACCCAGGCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000697
ALOX12 MISSION shRNA shRNA Plasmid DNA
arachidonate 12-lipoxygenase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-411s1c1
Sequence:CCGGGCATCGAGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-859s1c1
Sequence:CCGGGCTGACTTCATCCTTCTGGATCTCGAGATCCAGAAGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1482s1c1
Sequence:CCGGCCAAAGGGATGACATAGTGAACTCGAGTTCACTATGTCATCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-514s1c1
Sequence:CCGGCCTCCAAATATGAGATTCCATCTCGAGATGGAATCTCATATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1891s1c1
Sequence:CCGGCCCAAAGCTGTGCTAAACCAACTCGAGTTGGTTTAGCACAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-605s21c1
Sequence:CCGGGATGGCCCTCAAACGTGTTTACTCGAGTAAACACGTTTGAGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-1701s21c1
Sequence:CCGGTGGTATGCCTGGGTCCCTAATCTCGAGATTAGGGACCCAGGCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000697
ALOX12 MISSION shRNA Lentiviral Transduction Particles
arachidonate 12-lipoxygenase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-411s1c1
Sequence:CCGGGCATCGAGAGAAGGAACTGAACTCGAGTTCAGTTCCTTCTCTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-859s1c1
Sequence:CCGGGCTGACTTCATCCTTCTGGATCTCGAGATCCAGAAGGATGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1482s1c1
Sequence:CCGGCCAAAGGGATGACATAGTGAACTCGAGTTCACTATGTCATCCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-514s1c1
Sequence:CCGGCCTCCAAATATGAGATTCCATCTCGAGATGGAATCTCATATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000697.1-1891s1c1
Sequence:CCGGCCCAAAGCTGTGCTAAACCAACTCGAGTTGGTTTAGCACAGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-605s21c1
Sequence:CCGGGATGGCCCTCAAACGTGTTTACTCGAGTAAACACGTTTGAGGGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000697.2-1701s21c1
Sequence:CCGGTGGTATGCCTGGGTCCCTAATCTCGAGATTAGGGACCCAGGCATACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007440
ALOX12 MISSION shRNA Bacterial Glycerol Stock
arachidonate 12-lipoxygenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-2008s1c1
Sequence:CCGGCCTGCCTTATGAATACCTCAACTCGAGTTGAGGTATTCATAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-885s1c1
Sequence:CCGGCCCTGTTTGAAGCTGACTTTACTCGAGTAAAGTCAGCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1338s1c1
Sequence:CCGGGCGGCCATGTTCAGTTGCTTACTCGAGTAAGCAACTGAACATGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1940s1c1
Sequence:CCGGCTCAGCCAATTTCAAGCAGATCTCGAGATCTGCTTGAAATTGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-416s1c1
Sequence:CCGGGCAGGAGACAATGCCTTAGATCTCGAGATCTAAGGCATTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007440
ALOX12 MISSION shRNA shRNA Plasmid DNA
arachidonate 12-lipoxygenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-2008s1c1
Sequence:CCGGCCTGCCTTATGAATACCTCAACTCGAGTTGAGGTATTCATAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-885s1c1
Sequence:CCGGCCCTGTTTGAAGCTGACTTTACTCGAGTAAAGTCAGCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1338s1c1
Sequence:CCGGGCGGCCATGTTCAGTTGCTTACTCGAGTAAGCAACTGAACATGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1940s1c1
Sequence:CCGGCTCAGCCAATTTCAAGCAGATCTCGAGATCTGCTTGAAATTGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-416s1c1
Sequence:CCGGGCAGGAGACAATGCCTTAGATCTCGAGATCTAAGGCATTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007440
ALOX12 MISSION shRNA Lentiviral Transduction Particles
arachidonate 12-lipoxygenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-2008s1c1
Sequence:CCGGCCTGCCTTATGAATACCTCAACTCGAGTTGAGGTATTCATAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-885s1c1
Sequence:CCGGCCCTGTTTGAAGCTGACTTTACTCGAGTAAAGTCAGCTTCAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1338s1c1
Sequence:CCGGGCGGCCATGTTCAGTTGCTTACTCGAGTAAGCAACTGAACATGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-1940s1c1
Sequence:CCGGCTCAGCCAATTTCAAGCAGATCTCGAGATCTGCTTGAAATTGGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007440.2-416s1c1
Sequence:CCGGGCAGGAGACAATGCCTTAGATCTCGAGATCTAAGGCATTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks