EMAIL THIS PAGE TO A FRIEND

ALOX12B

arachidonate 12-lipoxygenase, 12R type

46 Gene Product Result for
Synonyms: 12R-LOX ARCI2
UniProtKB ID: O75342
Gene ID:
Human(242) Summary: This gene encodes an enzyme involved in the converstion of arachidonic acid to 12R-hydroxyeicosatetraenoic acid. Mutations in this gene are associated with nonbullous congenital ichthyosiform erythroderma. [provided by RefSeq, Jul 2008]
Mouse(11686) arachidonate 12-lipoxygenase, 12R type
Rat(287425) arachidonate 12-lipoxygenase, 12R type
sheep(101105929) arachidonate 12-lipoxygenase, 12R type
domestic guinea pig(100731997) arachidonate 12-lipoxygenase, 12R type
naked mole-rat(101708945) arachidonate 12-lipoxygenase, 12R type
dog(489486) arachidonate 12-lipoxygenase, 12R type
Horse(100062323) arachidonate 12-lipoxygenase, 12R type
cow(504803) arachidonate 12-lipoxygenase, 12R type
domestic cat(101101263) arachidonate 12-lipoxygenase, 12R type
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001139 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119511 MISSION® esiRNA esiRNA human ALOX12B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001139 Rosetta Predictions human pricing
NM_001039377 Rosetta Predictions rat pricing
NM_009659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045672 predicted 830
2 SASI_Hs01_00045674 predicted 1550
3 SASI_Hs01_00045675 predicted 1803
4 SASI_Hs01_00045676 predicted 1806
5 SASI_Hs01_00045677 predicted 1947
6 SASI_Hs01_00045678 predicted 806
7 SASI_Hs02_00331226 predicted 1288
8 SASI_Hs01_00045679 predicted 866
9 SASI_Hs01_00045680 predicted 816
10 SASI_Hs01_00045681 predicted 497
11 SASI_Hs01_00045673 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037000 predicted 1962
2 SASI_Rn01_00037001 predicted 1688
3 SASI_Rn01_00037002 predicted 1240
4 SASI_Rn01_00037003 predicted 1170
5 SASI_Rn01_00037004 predicted 1619
6 SASI_Rn01_00037005 predicted 713
7 SASI_Rn01_00037006 predicted 1086
8 SASI_Rn01_00037007 predicted 1240
9 SASI_Rn01_00037008 predicted 1987
10 SASI_Rn02_00204835 predicted 2013
11 SASI_Rn01_00037009 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070284 predicted 871
2 SASI_Mm01_00070285 predicted 756
3 SASI_Mm01_00070286 predicted 1869
4 SASI_Mm01_00070287 predicted 723
5 SASI_Mm01_00070288 predicted 976
6 SASI_Mm01_00070289 predicted 921
7 SASI_Mm01_00070290 predicted 1714
8 SASI_Mm01_00070291 predicted 1997
9 SASI_Mm01_00070292 predicted 1263
10 SASI_Mm02_00316662 predicted 1844
11 SASI_Mm01_00070283 predicted 1444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001139
ALOX12B MISSION shRNA Bacterial Glycerol Stock
arachidonate 12-lipoxygenase, 12R type
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1864s21c1
Sequence:CCGGTCTTGGGTGCAGGAAATATTTCTCGAGAAATATTTCCTGCACCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-345s21c1
Sequence:CCGGGACACAAGGAGAGAGCCATAACTCGAGTTATGGCTCTCTCCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1800s21c1
Sequence:CCGGGACGGAGATCATCACCTATTACTCGAGTAATAGGTGATGATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-2340s21c1
Sequence:CCGGGCTGATTGAGAACAGCATTTCCTCGAGGAAATGCTGTTCTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-782s1c1
Sequence:CCGGCCTGAGTGGAATGGCTATATTCTCGAGAATATAGCCATTCCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1951s1c1
Sequence:CCGGCCGATATGTCACTATAGTCATCTCGAGATGACTATAGTGACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-505s1c1
Sequence:CCGGGTACTGCAACTATGTGCAGATCTCGAGATCTGCACATAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-811s1c1
Sequence:CCGGCCCAATTCTCATCAACTTTAACTCGAGTTAAAGTTGATGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1739s1c1
Sequence:CCGGCCTGGATATTACTACCGCGATCTCGAGATCGCGGTAGTAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001139
ALOX12B MISSION shRNA shRNA Plasmid DNA
arachidonate 12-lipoxygenase, 12R type
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1864s21c1
Sequence:CCGGTCTTGGGTGCAGGAAATATTTCTCGAGAAATATTTCCTGCACCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-345s21c1
Sequence:CCGGGACACAAGGAGAGAGCCATAACTCGAGTTATGGCTCTCTCCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1800s21c1
Sequence:CCGGGACGGAGATCATCACCTATTACTCGAGTAATAGGTGATGATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-2340s21c1
Sequence:CCGGGCTGATTGAGAACAGCATTTCCTCGAGGAAATGCTGTTCTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-782s1c1
Sequence:CCGGCCTGAGTGGAATGGCTATATTCTCGAGAATATAGCCATTCCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1951s1c1
Sequence:CCGGCCGATATGTCACTATAGTCATCTCGAGATGACTATAGTGACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-505s1c1
Sequence:CCGGGTACTGCAACTATGTGCAGATCTCGAGATCTGCACATAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-811s1c1
Sequence:CCGGCCCAATTCTCATCAACTTTAACTCGAGTTAAAGTTGATGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1739s1c1
Sequence:CCGGCCTGGATATTACTACCGCGATCTCGAGATCGCGGTAGTAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001139
ALOX12B MISSION shRNA Lentiviral Transduction Particles
arachidonate 12-lipoxygenase, 12R type
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1864s21c1
Sequence:CCGGTCTTGGGTGCAGGAAATATTTCTCGAGAAATATTTCCTGCACCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-345s21c1
Sequence:CCGGGACACAAGGAGAGAGCCATAACTCGAGTTATGGCTCTCTCCTTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-1800s21c1
Sequence:CCGGGACGGAGATCATCACCTATTACTCGAGTAATAGGTGATGATCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139.2-2340s21c1
Sequence:CCGGGCTGATTGAGAACAGCATTTCCTCGAGGAAATGCTGTTCTCAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-782s1c1
Sequence:CCGGCCTGAGTGGAATGGCTATATTCTCGAGAATATAGCCATTCCACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1951s1c1
Sequence:CCGGCCGATATGTCACTATAGTCATCTCGAGATGACTATAGTGACATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-505s1c1
Sequence:CCGGGTACTGCAACTATGTGCAGATCTCGAGATCTGCACATAGTTGCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-811s1c1
Sequence:CCGGCCCAATTCTCATCAACTTTAACTCGAGTTAAAGTTGATGAGAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001139.1-1739s1c1
Sequence:CCGGCCTGGATATTACTACCGCGATCTCGAGATCGCGGTAGTAATATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009659
ALOX12B MISSION shRNA Bacterial Glycerol Stock
arachidonate 12-lipoxygenase, 12R type
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-973s1c1
Sequence:CCGGCCAGTACCTTAATGGTATTAACTCGAGTTAATACCATTAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1469s1c1
Sequence:CCGGCGGTACAACGTCCAGATCAATCTCGAGATTGATCTGGACGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1712s1c1
Sequence:CCGGGTGACAGAGATCATCACTTATCTCGAGATAAGTGATGATCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-721s1c1
Sequence:CCGGCGGATTCCCAATTCTCATCAACTCGAGTTGATGAGAATTGGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1861s1c1
Sequence:CCGGGCTGATCGAATACGTCACAATCTCGAGATTGTGACGTATTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009659
ALOX12B MISSION shRNA shRNA Plasmid DNA
arachidonate 12-lipoxygenase, 12R type
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-973s1c1
Sequence:CCGGCCAGTACCTTAATGGTATTAACTCGAGTTAATACCATTAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1469s1c1
Sequence:CCGGCGGTACAACGTCCAGATCAATCTCGAGATTGATCTGGACGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1712s1c1
Sequence:CCGGGTGACAGAGATCATCACTTATCTCGAGATAAGTGATGATCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-721s1c1
Sequence:CCGGCGGATTCCCAATTCTCATCAACTCGAGTTGATGAGAATTGGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1861s1c1
Sequence:CCGGGCTGATCGAATACGTCACAATCTCGAGATTGTGACGTATTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009659
ALOX12B MISSION shRNA Lentiviral Transduction Particles
arachidonate 12-lipoxygenase, 12R type
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-973s1c1
Sequence:CCGGCCAGTACCTTAATGGTATTAACTCGAGTTAATACCATTAAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1469s1c1
Sequence:CCGGCGGTACAACGTCCAGATCAATCTCGAGATTGATCTGGACGTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1712s1c1
Sequence:CCGGGTGACAGAGATCATCACTTATCTCGAGATAAGTGATGATCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-721s1c1
Sequence:CCGGCGGATTCCCAATTCTCATCAACTCGAGTTGATGAGAATTGGGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009659.1-1861s1c1
Sequence:CCGGGCTGATCGAATACGTCACAATCTCGAGATTGTGACGTATTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks