EMAIL THIS PAGE TO A FRIEND

ALOX15

arachidonate 15-lipoxygenase

90 Gene Product Result for
Synonyms: 15-LOX-1 15LOX-1
UniProtKB ID: P16050, A8K2P4, Q8N6R7, Q99657
Gene ID:
Mouse(11687) arachidonate 15-lipoxygenase
Rat(81639) arachidonate 15-lipoxygenase
cow(282139) arachidonate 15-lipoxygenase
dog(489458) arachidonate 15-lipoxygenase
Domestic Rabbit(100009114) arachidonate 15-lipoxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001140 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071621 MISSION® esiRNA esiRNA targeting mouse Alox15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001140 Rosetta Predictions human pricing
NM_031010 Rosetta Predictions rat pricing
NM_009660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117888 predicted 568
2 SASI_Hs01_00117890 predicted 566
3 SASI_Hs01_00117892 predicted 1472
4 SASI_Hs01_00117893 predicted 1752
5 SASI_Hs01_00117894 predicted 1159
6 SASI_Hs02_00331227 predicted 435
7 SASI_Hs01_00117896 predicted 1407
8 SASI_Hs01_00117897 predicted 1436
9 SASI_Hs02_00331228 predicted 1185
10 SASI_Hs02_00331229 predicted 1374
11 SASI_Hs01_00117889 predicted 1107
12 SASI_Hs01_00117891 predicted 913
13 SASI_Hs01_00117895 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044548 predicted 980
2 SASI_Rn01_00044549 predicted 1096
3 SASI_Rn02_00264200 predicted 831
4 SASI_Rn01_00044550 predicted 205
5 SASI_Rn01_00044551 predicted 558
6 SASI_Rn01_00044552 predicted 1292
7 SASI_Rn01_00044553 predicted 1180
8 SASI_Rn01_00044554 predicted 1914
9 SASI_Rn01_00044555 predicted 852
10 SASI_Rn01_00044556 predicted 1224
11 SASI_Rn01_00044557 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113740 predicted 846
2 SASI_Mm01_00113742 predicted 877
3 SASI_Mm01_00113743 predicted 568
4 SASI_Mm02_00316663 predicted 2044
5 SASI_Mm01_00113744 predicted 617
6 SASI_Mm01_00113746 predicted 876
7 SASI_Mm01_00113748 predicted 1046
8 SASI_Mm02_00316664 predicted 2027
9 SASI_Mm02_00316665 predicted 202
10 SASI_Mm01_00113749 predicted 1383
11 SASI_Mm01_00113741 predicted 1591
12 SASI_Mm01_00113745 predicted 475
13 SASI_Mm01_00113747 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009660
ALOX15 MISSION shRNA Bacterial Glycerol Stock
arachidonate 15-lipoxygenase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000076445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-190s1c1
Sequence:CCGGGCTGTTTGTGAGAGTGCAGAACTCGAGTTCTGCACTCTCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-1591s1c1
Sequence:CCGGCCACTTCATCACCATGTGCATCTCGAGATGCACATGGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009660.2-2010s1c1
Sequence:CCGGCCCTCTCGATTGGTTATTTAACTCGAGTTAAATAACCAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-826s1c1
Sequence:CCGGCACTCTGTTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009660
ALOX15 MISSION shRNA shRNA Plasmid DNA
arachidonate 15-lipoxygenase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000076445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-190s1c1
Sequence:CCGGGCTGTTTGTGAGAGTGCAGAACTCGAGTTCTGCACTCTCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-1591s1c1
Sequence:CCGGCCACTTCATCACCATGTGCATCTCGAGATGCACATGGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009660.2-2010s1c1
Sequence:CCGGCCCTCTCGATTGGTTATTTAACTCGAGTTAAATAACCAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-826s1c1
Sequence:CCGGCACTCTGTTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009660
ALOX15 MISSION shRNA Lentiviral Transduction Particles
arachidonate 15-lipoxygenase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000076445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-190s1c1
Sequence:CCGGGCTGTTTGTGAGAGTGCAGAACTCGAGTTCTGCACTCTCACAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-1591s1c1
Sequence:CCGGCCACTTCATCACCATGTGCATCTCGAGATGCACATGGTGATGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076443    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009660.2-2010s1c1
Sequence:CCGGCCCTCTCGATTGGTTATTTAACTCGAGTTAAATAACCAATCGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009660.2-826s1c1
Sequence:CCGGCACTCTGTTTGAAGCGGATTTCTCGAGAAATCCGCTTCAAACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001140
ALOX15 MISSION shRNA Bacterial Glycerol Stock
arachidonate 15-lipoxygenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-570s1c1
Sequence:CCGGGCTATCAAAGACTCTCTAAATCTCGAGATTTAGAGAGTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-676s1c1
Sequence:CCGGCCTGGAAGGAAGATGCCTTATCTCGAGATAAGGCATCTTCCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1151s1c1
Sequence:CCGGGCCGTCGATACATCCTATCTTCTCGAGAAGATAGGATGTATCGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-704s1c1
Sequence:CCGGCCAGTTTCTTAATGGCGCCAACTCGAGTTGGCGCCATTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1416s1c1
Sequence:CCGGTGGGAAATCATCTATCGGTATCTCGAGATACCGATAGATGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-439s21c1
Sequence:CCGGGAAACTGGAAGGACGGGTTAACTCGAGTTAACCCGTCCTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-613s21c1
Sequence:CCGGTAGATGACTTCAACCGGATTTCTCGAGAAATCCGGTTGAAGTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-1662s21c1
Sequence:CCGGTGGTACTCTTGGGTGCCTAATCTCGAGATTAGGCACCCAAGAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001140
ALOX15 MISSION shRNA shRNA Plasmid DNA
arachidonate 15-lipoxygenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-570s1c1
Sequence:CCGGGCTATCAAAGACTCTCTAAATCTCGAGATTTAGAGAGTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-676s1c1
Sequence:CCGGCCTGGAAGGAAGATGCCTTATCTCGAGATAAGGCATCTTCCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1151s1c1
Sequence:CCGGGCCGTCGATACATCCTATCTTCTCGAGAAGATAGGATGTATCGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-704s1c1
Sequence:CCGGCCAGTTTCTTAATGGCGCCAACTCGAGTTGGCGCCATTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1416s1c1
Sequence:CCGGTGGGAAATCATCTATCGGTATCTCGAGATACCGATAGATGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-439s21c1
Sequence:CCGGGAAACTGGAAGGACGGGTTAACTCGAGTTAACCCGTCCTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-613s21c1
Sequence:CCGGTAGATGACTTCAACCGGATTTCTCGAGAAATCCGGTTGAAGTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-1662s21c1
Sequence:CCGGTGGTACTCTTGGGTGCCTAATCTCGAGATTAGGCACCCAAGAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001140
ALOX15 MISSION shRNA Lentiviral Transduction Particles
arachidonate 15-lipoxygenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-570s1c1
Sequence:CCGGGCTATCAAAGACTCTCTAAATCTCGAGATTTAGAGAGTCTTTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-676s1c1
Sequence:CCGGCCTGGAAGGAAGATGCCTTATCTCGAGATAAGGCATCTTCCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1151s1c1
Sequence:CCGGGCCGTCGATACATCCTATCTTCTCGAGAAGATAGGATGTATCGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-704s1c1
Sequence:CCGGCCAGTTTCTTAATGGCGCCAACTCGAGTTGGCGCCATTAAGAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001140.3-1416s1c1
Sequence:CCGGTGGGAAATCATCTATCGGTATCTCGAGATACCGATAGATGATTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-439s21c1
Sequence:CCGGGAAACTGGAAGGACGGGTTAACTCGAGTTAACCCGTCCTTCCAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-613s21c1
Sequence:CCGGTAGATGACTTCAACCGGATTTCTCGAGAAATCCGGTTGAAGTCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001140.3-1662s21c1
Sequence:CCGGTGGTACTCTTGGGTGCCTAATCTCGAGATTAGGCACCCAAGAGTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks