EMAIL THIS PAGE TO A FRIEND

ALOX15B

arachidonate 15-lipoxygenase, type B

61 Gene Product Result for
Synonyms: 15-LOX-2
Gene ID:
Human(247) Summary: This gene encodes a member of the lipoxygenase family of structurally related nonheme iron dioxygenases involved in the production of fatty acid hydroperoxides. The encoded protein converts arachidonic acid exclusively to 15S-hydroperoxyeicosatetraenoic acid, while metabolizing linoleic acid less effectively. This gene is located in a cluster of related genes and a pseudogene that spans approximately 100 kilobases on the short arm of chromosome 17. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Rat(266604) arachidonate 15-lipoxygenase, type B
Domestic Rabbit(100342479) arachidonate 15-lipoxygenase, type B
domestic guinea pig(100732272) arachidonate 15-lipoxygenase, type B
cow(286820) arachidonate 15-lipoxygenase, type B
Horse(100073039) arachidonate 15-lipoxygenase, type B
domestic cat(101101264) arachidonate 15-lipoxygenase, type B
dog(489485) arachidonate 15-lipoxygenase, type B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001141 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063701 MISSION® esiRNA esiRNA human ALOX15B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039130 Rosetta Predictions human pricing
NM_001039131 Rosetta Predictions human pricing
NM_001141 Rosetta Predictions human pricing
NM_153301 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308433 predicted 1808
2 SASI_Hs01_00078292 predicted 1886
3 SASI_Hs01_00078293 predicted 1047
4 SASI_Hs01_00078295 predicted 612
5 SASI_Hs01_00078297 predicted 1001
6 SASI_Hs01_00078298 predicted 970
7 SASI_Hs01_00078299 predicted 623
8 SASI_Hs01_00078300 predicted 303
9 SASI_Hs01_00078301 predicted 860
10 SASI_Hs02_00308434 predicted 236
11 SASI_Hs01_00078294 predicted 941
12 SASI_Hs01_00078296 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039131 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216503 predicted 2035
2 SASI_Hs01_00216504 predicted 1754
3 SASI_Hs01_00216505 predicted 737
4 SASI_Hs01_00216506 predicted 1956
5 SASI_Hs01_00216507 predicted 616
6 SASI_Hs01_00216508 predicted 996
7 SASI_Hs01_00216509 predicted 969
8 SASI_Hs01_00216510 predicted 818
9 SASI_Hs01_00216511 predicted 626
10 SASI_Hs01_00216512 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079569 predicted 2253
2 SASI_Hs01_00079570 predicted 1971
3 SASI_Hs01_00079571 predicted 737
4 SASI_Hs01_00079572 predicted 2176
5 SASI_Hs01_00079573 predicted 620
6 SASI_Hs01_00079574 predicted 1000
7 SASI_Hs01_00079575 predicted 963
8 SASI_Hs01_00079576 predicted 815
9 SASI_Hs01_00079577 predicted 627
10 SASI_Hs01_00079578 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268945 predicted 1705
2 SASI_Rn01_00092932 predicted 1464
3 SASI_Rn02_00268946 predicted 527
4 SASI_Rn01_00092933 predicted 1812
5 SASI_Rn01_00092934 predicted 1469
6 SASI_Rn01_00092935 predicted 673
7 SASI_Rn01_00092936 predicted 699
8 SASI_Rn01_00092937 predicted 975
9 SASI_Rn01_00092938 predicted 554
10 SASI_Rn01_00092940 predicted 1598
11 SASI_Rn01_00092939 predicted 1907
12 SASI_Rn01_00092941 predicted 785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001141
ALOX15B MISSION shRNA Bacterial Glycerol Stock
arachidonate 15-lipoxygenase, type B
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141.2-2184s21c1
Sequence:CCGGGACCACATCGCTCTAGGATAACTCGAGTTATCCTAGAGCGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141.2-1334s21c1
Sequence:CCGGCCGATACACCCTGCACATCAACTCGAGTTGATGTGCAGGGTGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1491s1c1
Sequence:CCGGCGTGATGATGGGATGCAGATTCTCGAGAATCTGCATCCCATCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-692s1c1
Sequence:CCGGGAGGAGTCTGAATGAGATGAACTCGAGTTCATCTCATTCAGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1535s1c1
Sequence:CCGGCTCTGAAATCATCGGTATCTACTCGAGTAGATACCGATGATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1688s1c1
Sequence:CCGGGCAGTATGTCACCATGGTGATCTCGAGATCACCATGGTGACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001141
ALOX15B MISSION shRNA shRNA Plasmid DNA
arachidonate 15-lipoxygenase, type B
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141.2-2184s21c1
Sequence:CCGGGACCACATCGCTCTAGGATAACTCGAGTTATCCTAGAGCGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141.2-1334s21c1
Sequence:CCGGCCGATACACCCTGCACATCAACTCGAGTTGATGTGCAGGGTGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1491s1c1
Sequence:CCGGCGTGATGATGGGATGCAGATTCTCGAGAATCTGCATCCCATCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-692s1c1
Sequence:CCGGGAGGAGTCTGAATGAGATGAACTCGAGTTCATCTCATTCAGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1535s1c1
Sequence:CCGGCTCTGAAATCATCGGTATCTACTCGAGTAGATACCGATGATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1688s1c1
Sequence:CCGGGCAGTATGTCACCATGGTGATCTCGAGATCACCATGGTGACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001141
ALOX15B MISSION shRNA Lentiviral Transduction Particles
arachidonate 15-lipoxygenase, type B
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001141.2-2184s21c1
Sequence:CCGGGACCACATCGCTCTAGGATAACTCGAGTTATCCTAGAGCGATGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001141.2-1334s21c1
Sequence:CCGGCCGATACACCCTGCACATCAACTCGAGTTGATGTGCAGGGTGTATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1491s1c1
Sequence:CCGGCGTGATGATGGGATGCAGATTCTCGAGAATCTGCATCCCATCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-692s1c1
Sequence:CCGGGAGGAGTCTGAATGAGATGAACTCGAGTTCATCTCATTCAGACTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1535s1c1
Sequence:CCGGCTCTGAAATCATCGGTATCTACTCGAGTAGATACCGATGATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001141.1-1688s1c1
Sequence:CCGGGCAGTATGTCACCATGGTGATCTCGAGATCACCATGGTGACATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks