EMAIL THIS PAGE TO A FRIEND

ALOX5

arachidonate 5-lipoxygenase

86 Gene Product Result for
Synonyms: 5-LO 5-LOX 5LPG LOG5
UniProtKB ID: P09917, B7ZLS0, Q5JQ14
Gene ID:
Human(240) Summary: This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(11689) arachidonate 5-lipoxygenase
Rat(25290) arachidonate 5-lipoxygenase
Zebrafish(573013) arachidonate 5-lipoxygenase
chicken(423769) arachidonate 5-lipoxygenase
dog(477753) arachidonate 5-lipoxygenase
domestic cat(101097422) arachidonate 5-lipoxygenase
cow(404074) arachidonate 5-lipoxygenase
Horse(100062042) arachidonate 5-lipoxygenase
Zebrafish(567204) arachidonate 5-lipoxygenase
domestic guinea pig(100718093) arachidonate 5-lipoxygenase
naked mole-rat(101700210) arachidonate 5-lipoxygenase
sheep(101117390) arachidonate 5-lipoxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N194 NS-398 ≥98% (HPLC), solid human, mouse pricing
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing
E2011 cis-5,8,11,14,17-Eicosapentaenoic acid ≥99% human, mouse, rat pricing
E6627 cis-5,8,11,14,17-Eicosapentaenoic acid sodium salt ≥99% (capillary GC) human, mouse, rat pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
284785 (S)-(+)-6-Methoxy-α-methyl-2-naphthaleneacetic acid 98% human, rat pricing
100633 1-(2-Hydroxyphenyl)-3-phenyl-2-propenone 98% human, rat pricing
B7559 BW A4C ≥98% (HPLC) human, rat pricing
C0625 Caffeic acid ≥98.0% (HPLC) human, rat pricing
60018 Caffeic acid matrix substance for MALDI-MS, ≥99.0% (HPLC) human, rat pricing
60020 Caffeic acid purum, ≥95.0% (HPLC) human, rat pricing
N8280 Naproxen meets USP testing specifications human, rat pricing
46482 Naproxen VETRANAL, analytical standard human, rat pricing
P5654 Piroxicam ≥98% (TLC) human, rat pricing
P0847 Piroxicam meets USP testing specifications human, rat pricing
R5523 REV 5901 human, rat pricing
S0193 SKF-86002 ≥98% (HPLC), solid human, rat pricing
465119 Baicalein 98% mouse, rat pricing
127914 1-Phenyl-3-pyrazolidinone 97% rat pricing
I2606 3-Indazolinone 97% rat pricing
B178 Butein solid rat pricing
I3766 Isoliquiritigenin powder rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000698 Rosetta Predictions human pricing
NM_012822 Rosetta Predictions rat pricing
NM_009662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022392 predicted 786
2 SASI_Hs01_00022393 predicted 2006
3 SASI_Hs01_00022394 predicted 688
4 SASI_Hs01_00022395 predicted 1084
5 SASI_Hs01_00022396 predicted 627
6 SASI_Hs01_00022397 predicted 668
7 SASI_Hs01_00022398 predicted 1213
8 SASI_Hs01_00022399 predicted 1167
9 SASI_Hs01_00022400 predicted 1201
10 SASI_Hs01_00022401 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098441 predicted 1981
2 SASI_Rn01_00098442 predicted 1672
3 SASI_Rn01_00098443 predicted 1516
4 SASI_Rn01_00098444 predicted 1480
5 SASI_Rn01_00098445 predicted 302
6 SASI_Rn01_00098446 predicted 2084
7 SASI_Rn01_00098447 predicted 946
8 SASI_Rn01_00098448 predicted 375
9 SASI_Rn01_00098449 predicted 1693
10 SASI_Rn01_00098450 predicted 2024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047794 predicted 1601
2 SASI_Mm01_00047795 predicted 615
3 SASI_Mm01_00047796 predicted 223
4 SASI_Mm01_00047797 predicted 369
5 SASI_Mm01_00047798 predicted 1547
6 SASI_Mm01_00047800 predicted 1101
7 SASI_Mm01_00047801 predicted 1811
8 SASI_Mm01_00047802 predicted 381
9 SASI_Mm02_00316676 predicted 444
10 SASI_Mm01_00047803 predicted 2051
11 SASI_Mm01_00047799 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000698
ALOX5 MISSION shRNA Bacterial Glycerol Stock
arachidonate 5-lipoxygenase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-608s1c1
Sequence:CCGGCCTGTTCATCAACCGCTTCATCTCGAGATGAAGCGGTTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1039s1c1
Sequence:CCGGCGGGAGATGAGAACCCTATTTCTCGAGAAATAGGGTTCTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-405s1c1
Sequence:CCGGCGAGATGACCAAATTCACATTCTCGAGAATGTGAATTTGGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-538s1c1
Sequence:CCGGCCCGTGATATCCAGTTTGATACTCGAGTATCAAACTGGATATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1505s1c1
Sequence:CCGGCGAGGTGGTAGACATCTACTACTCGAGTAGTAGATGTCTACCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-704s21c1
Sequence:CCGGGGAATGACTTCGCCGACTTTGCTCGAGCAAAGTCGGCGAAGTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000698.2-2395s21c1
Sequence:CCGGGACCACTGATAGATGTCTATTCTCGAGAATAGACATCTATCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-737s21c1
Sequence:CCGCTCAAGATCAGCAACACTATTTCTCGAGAAATAGTGTTGCTGATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000698
ALOX5 MISSION shRNA shRNA Plasmid DNA
arachidonate 5-lipoxygenase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-608s1c1
Sequence:CCGGCCTGTTCATCAACCGCTTCATCTCGAGATGAAGCGGTTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1039s1c1
Sequence:CCGGCGGGAGATGAGAACCCTATTTCTCGAGAAATAGGGTTCTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-405s1c1
Sequence:CCGGCGAGATGACCAAATTCACATTCTCGAGAATGTGAATTTGGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-538s1c1
Sequence:CCGGCCCGTGATATCCAGTTTGATACTCGAGTATCAAACTGGATATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1505s1c1
Sequence:CCGGCGAGGTGGTAGACATCTACTACTCGAGTAGTAGATGTCTACCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-704s21c1
Sequence:CCGGGGAATGACTTCGCCGACTTTGCTCGAGCAAAGTCGGCGAAGTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000698.2-2395s21c1
Sequence:CCGGGACCACTGATAGATGTCTATTCTCGAGAATAGACATCTATCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-737s21c1
Sequence:CCGCTCAAGATCAGCAACACTATTTCTCGAGAAATAGTGTTGCTGATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000698
ALOX5 MISSION shRNA Lentiviral Transduction Particles
arachidonate 5-lipoxygenase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-608s1c1
Sequence:CCGGCCTGTTCATCAACCGCTTCATCTCGAGATGAAGCGGTTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1039s1c1
Sequence:CCGGCGGGAGATGAGAACCCTATTTCTCGAGAAATAGGGTTCTCATCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-405s1c1
Sequence:CCGGCGAGATGACCAAATTCACATTCTCGAGAATGTGAATTTGGTCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-538s1c1
Sequence:CCGGCCCGTGATATCCAGTTTGATACTCGAGTATCAAACTGGATATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000698.1-1505s1c1
Sequence:CCGGCGAGGTGGTAGACATCTACTACTCGAGTAGTAGATGTCTACCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-704s21c1
Sequence:CCGGGGAATGACTTCGCCGACTTTGCTCGAGCAAAGTCGGCGAAGTCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412516    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000698.2-2395s21c1
Sequence:CCGGGACCACTGATAGATGTCTATTCTCGAGAATAGACATCTATCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000698.2-737s21c1
Sequence:CCGCTCAAGATCAGCAACACTATTTCTCGAGAAATAGTGTTGCTGATCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009662
ALOX5 MISSION shRNA Bacterial Glycerol Stock
arachidonate 5-lipoxygenase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009662.1-961s1c1
Sequence:CCGGGCAGCTCAGTTTAGAACAGGACTCGAGTCCTGTTCTAAACTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-509s21c1
Sequence:CCGGTTGGCCCGAGATGACCAAATTCTCGAGAATTTGGTCATCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009662.2-2471s21c1
Sequence:CCGGACTCGGTAGCATCAGAATAAGCTCGAGCTTATTCTGATGCTACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009662.2-2470s1c1
Sequence:CCGGCACTCGGTAGCATCAGAATAACTCGAGTTATTCTGATGCTACCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-1169s21c1
Sequence:CCGGTTCCTCCCTACGGATTCAAAGCTCGAGCTTTGAATCCGTAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-536s21c1
Sequence:CCGGCTCAAGCAGCACAGACGTAAACTCGAGTTTACGTCTGTGCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009662
ALOX5 MISSION shRNA shRNA Plasmid DNA
arachidonate 5-lipoxygenase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009662.1-961s1c1
Sequence:CCGGGCAGCTCAGTTTAGAACAGGACTCGAGTCCTGTTCTAAACTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-509s21c1
Sequence:CCGGTTGGCCCGAGATGACCAAATTCTCGAGAATTTGGTCATCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009662.2-2471s21c1
Sequence:CCGGACTCGGTAGCATCAGAATAAGCTCGAGCTTATTCTGATGCTACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009662.2-2470s1c1
Sequence:CCGGCACTCGGTAGCATCAGAATAACTCGAGTTATTCTGATGCTACCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-1169s21c1
Sequence:CCGGTTCCTCCCTACGGATTCAAAGCTCGAGCTTTGAATCCGTAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-536s21c1
Sequence:CCGGCTCAAGCAGCACAGACGTAAACTCGAGTTTACGTCTGTGCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009662
ALOX5 MISSION shRNA Lentiviral Transduction Particles
arachidonate 5-lipoxygenase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009662.1-961s1c1
Sequence:CCGGGCAGCTCAGTTTAGAACAGGACTCGAGTCCTGTTCTAAACTGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-509s21c1
Sequence:CCGGTTGGCCCGAGATGACCAAATTCTCGAGAATTTGGTCATCTCGGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254912    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009662.2-2471s21c1
Sequence:CCGGACTCGGTAGCATCAGAATAAGCTCGAGCTTATTCTGATGCTACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217752    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009662.2-2470s1c1
Sequence:CCGGCACTCGGTAGCATCAGAATAACTCGAGTTATTCTGATGCTACCGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-1169s21c1
Sequence:CCGGTTCCTCCCTACGGATTCAAAGCTCGAGCTTTGAATCCGTAGGGAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009662.2-536s21c1
Sequence:CCGGCTCAAGCAGCACAGACGTAAACTCGAGTTTACGTCTGTGCTGCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks