EMAIL THIS PAGE TO A FRIEND

ALOX5AP

arachidonate 5-lipoxygenase-activating protein

75 Gene Product Result for
Synonyms: FLAP
UniProtKB ID: P20292, Q5VV04
Gene ID:
Human(241) Summary: This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
Mouse(11690) arachidonate 5-lipoxygenase activating protein
Rat(29624) arachidonate 5-lipoxygenase activating protein
naked mole-rat(101704126) arachidonate 5-lipoxygenase-activating protein
domestic guinea pig(100733727) arachidonate 5-lipoxygenase-activating protein
Zebrafish(337376) arachidonate 5-lipoxygenase-activating protein
domestic cat(101090316) arachidonate 5-lipoxygenase-activating protein
cow(613869) arachidonate 5-lipoxygenase-activating protein
Horse(100034178) arachidonate 5-lipoxygenase-activating protein
dog(477323) arachidonate 5-lipoxygenase-activating protein
chicken(770904) arachidonate 5-lipoxygenase-activating protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B4558 BW B70C >98% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001629 Rosetta Predictions human pricing
NM_017260 Rosetta Predictions rat pricing
NM_009663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018694 predicted 334
2 SASI_Hs01_00018695 predicted 619
3 SASI_Hs01_00018696 predicted 587
4 SASI_Hs01_00018698 predicted 549
5 SASI_Hs01_00018699 predicted 321
6 SASI_Hs01_00018700 predicted 353
7 SASI_Hs01_00018701 predicted 464
8 SASI_Hs02_00332202 predicted 446
9 SASI_Hs01_00018702 predicted 301
10 SASI_Hs02_00332203 predicted 591
11 SASI_Hs01_00018697 predicted 426
12 SASI_Hs01_00018703 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076762 predicted 467
2 SASI_Rn01_00076763 predicted 528
3 SASI_Rn01_00076764 predicted 388
4 SASI_Rn01_00076765 predicted 461
5 SASI_Rn01_00076766 predicted 396
6 SASI_Rn01_00076767 predicted 615
7 SASI_Rn01_00076768 predicted 551
8 SASI_Rn01_00076769 predicted 544
9 SASI_Rn01_00076770 predicted 559
10 SASI_Rn02_00261655 predicted 195
11 SASI_Rn01_00076771 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186396 predicted 472
2 SASI_Mm01_00186398 predicted 375
3 SASI_Mm01_00186399 predicted 476
4 SASI_Mm01_00186402 predicted 560
5 SASI_Mm02_00316677 predicted 422
6 SASI_Mm01_00186404 predicted 546
7 SASI_Mm02_00316678 predicted 472
8 SASI_Mm02_00316679 predicted 254
9 SASI_Mm02_00316680 predicted 200
10 SASI_Mm02_00316681 predicted 400
11 SASI_Mm01_00186395 predicted 317
12 SASI_Mm01_00186397 predicted 600
13 SASI_Mm01_00186400 predicted 598
14 SASI_Mm01_00186401 predicted 565
15 SASI_Mm01_00186403 predicted 357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001629
ALOX5AP MISSION shRNA Bacterial Glycerol Stock
arachidonate 5-lipoxygenase-activating protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-577s21c1
Sequence:CCGGGGGTTGGTGTTCTCATCTAATCTCGAGATTAGATGAGAACACCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001629.2-447s21c1
Sequence:CCGGATGTCCGTTGCTGGCATATTCCTCGAGGAATATGCCAGCAACGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-678s21c1
Sequence:CCGGGGGCTTCACAGCTTGAGTTAACTCGAGTTAACTCAAGCTGTGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001629.2-641s1c1
Sequence:CCGGGCTCTTCTTTAGATGGCTGTACTCGAGTACAGCCATCTAAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-240s1c1
Sequence:CCGGGCCAACCAGAACTGTGTAGATCTCGAGATCTACACAGTTCTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-401s1c1
Sequence:CCGGCCCTGGCTACATATTTGGGAACTCGAGTTCCCAAATATGTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-407s1c1
Sequence:CCGGCTACATATTTGGGAAACGCATCTCGAGATGCGTTTCCCAAATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-330s1c1
Sequence:CCGGGCTGGACTGATGTACTTGTTTCTCGAGAAACAAGTACATCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001629
ALOX5AP MISSION shRNA shRNA Plasmid DNA
arachidonate 5-lipoxygenase-activating protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-577s21c1
Sequence:CCGGGGGTTGGTGTTCTCATCTAATCTCGAGATTAGATGAGAACACCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001629.2-447s21c1
Sequence:CCGGATGTCCGTTGCTGGCATATTCCTCGAGGAATATGCCAGCAACGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-678s21c1
Sequence:CCGGGGGCTTCACAGCTTGAGTTAACTCGAGTTAACTCAAGCTGTGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001629.2-641s1c1
Sequence:CCGGGCTCTTCTTTAGATGGCTGTACTCGAGTACAGCCATCTAAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-240s1c1
Sequence:CCGGGCCAACCAGAACTGTGTAGATCTCGAGATCTACACAGTTCTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-401s1c1
Sequence:CCGGCCCTGGCTACATATTTGGGAACTCGAGTTCCCAAATATGTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-407s1c1
Sequence:CCGGCTACATATTTGGGAAACGCATCTCGAGATGCGTTTCCCAAATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-330s1c1
Sequence:CCGGGCTGGACTGATGTACTTGTTTCTCGAGAAACAAGTACATCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001629
ALOX5AP MISSION shRNA Lentiviral Transduction Particles
arachidonate 5-lipoxygenase-activating protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-577s21c1
Sequence:CCGGGGGTTGGTGTTCTCATCTAATCTCGAGATTAGATGAGAACACCAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001629.2-447s21c1
Sequence:CCGGATGTCCGTTGCTGGCATATTCCTCGAGGAATATGCCAGCAACGGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001629.2-678s21c1
Sequence:CCGGGGGCTTCACAGCTTGAGTTAACTCGAGTTAACTCAAGCTGTGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001629.2-641s1c1
Sequence:CCGGGCTCTTCTTTAGATGGCTGTACTCGAGTACAGCCATCTAAAGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-240s1c1
Sequence:CCGGGCCAACCAGAACTGTGTAGATCTCGAGATCTACACAGTTCTGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-401s1c1
Sequence:CCGGCCCTGGCTACATATTTGGGAACTCGAGTTCCCAAATATGTAGCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-407s1c1
Sequence:CCGGCTACATATTTGGGAAACGCATCTCGAGATGCGTTTCCCAAATATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001629.2-330s1c1
Sequence:CCGGGCTGGACTGATGTACTTGTTTCTCGAGAAACAAGTACATCAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009663
ALOX5AP MISSION shRNA Bacterial Glycerol Stock
arachidonate 5-lipoxygenase-activating protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-321s1c1
Sequence:CCGGTGTACCTGTTTGTGAGGCAAACTCGAGTTTGCCTCACAAACAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-472s1c1
Sequence:CCGGCGGAAGCGACTTTGAGAACTACTCGAGTAGTTCTCAAAGTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-148s1c1
Sequence:CCGGGCATGAAAGCAAGGCGCATAACTCGAGTTATGCGCCTTGCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-311s1c1
Sequence:CCGGGCCGGACTGATGTACCTGTTTCTCGAGAAACAGGTACATCAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009663.1-614s1c1
Sequence:CCGGGCTCCTCTTCAAGCTGTAGATCTCGAGATCTACAGCTTGAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009663
ALOX5AP MISSION shRNA shRNA Plasmid DNA
arachidonate 5-lipoxygenase-activating protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-321s1c1
Sequence:CCGGTGTACCTGTTTGTGAGGCAAACTCGAGTTTGCCTCACAAACAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-472s1c1
Sequence:CCGGCGGAAGCGACTTTGAGAACTACTCGAGTAGTTCTCAAAGTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-148s1c1
Sequence:CCGGGCATGAAAGCAAGGCGCATAACTCGAGTTATGCGCCTTGCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-311s1c1
Sequence:CCGGGCCGGACTGATGTACCTGTTTCTCGAGAAACAGGTACATCAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009663.1-614s1c1
Sequence:CCGGGCTCCTCTTCAAGCTGTAGATCTCGAGATCTACAGCTTGAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009663
ALOX5AP MISSION shRNA Lentiviral Transduction Particles
arachidonate 5-lipoxygenase-activating protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-321s1c1
Sequence:CCGGTGTACCTGTTTGTGAGGCAAACTCGAGTTTGCCTCACAAACAGGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-472s1c1
Sequence:CCGGCGGAAGCGACTTTGAGAACTACTCGAGTAGTTCTCAAAGTCGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-148s1c1
Sequence:CCGGGCATGAAAGCAAGGCGCATAACTCGAGTTATGCGCCTTGCTTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009663.1-311s1c1
Sequence:CCGGGCCGGACTGATGTACCTGTTTCTCGAGAAACAGGTACATCAGTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009663.1-614s1c1
Sequence:CCGGGCTCCTCTTCAAGCTGTAGATCTCGAGATCTACAGCTTGAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks