EMAIL THIS PAGE TO A FRIEND

ALOXE3

arachidonate lipoxygenase 3

60 Gene Product Result for
Synonyms: ARCI3 E-LOX eLOX3
UniProtKB ID: Q9BYJ1, B2R981, B7Z3W0, Q3ZB74, Q9H4F2, Q9HC22
Gene ID:
Human(59344) Summary: This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(23801) arachidonate lipoxygenase 3
Rat(287424) arachidonate lipoxygenase 3
naked mole-rat(101709560) arachidonate lipoxygenase 3
domestic guinea pig(100731721) arachidonate lipoxygenase 3
sheep(101121693) arachidonate lipoxygenase 3
chicken(425997) arachidonate lipoxygenase 3
cow(517001) arachidonate lipoxygenase 3
Horse(100062351) arachidonate lipoxygenase 3
domestic cat(101101515) arachidonate lipoxygenase 3
dog(489487) arachidonate lipoxygenase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007441 MISSION® esiRNA esiRNA targeting human ALOXE3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021628 Rosetta Predictions human pricing
NM_001105793 Rosetta Predictions rat pricing
NM_011786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095974 predicted 1942
2 SASI_Hs01_00095975 predicted 1902
3 SASI_Hs01_00095976 predicted 1936
4 SASI_Hs01_00095977 predicted 1169
5 SASI_Hs01_00095978 predicted 372
6 SASI_Hs01_00095979 predicted 1823
7 SASI_Hs01_00095980 predicted 1581
8 SASI_Hs01_00095981 predicted 1811
9 SASI_Hs01_00095983 predicted 2098
10 SASI_Hs02_00354978 predicted 1923
11 SASI_Hs01_00095982 predicted 2390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212586 predicted 1584
2 SASI_Rn02_00212587 predicted 311
3 SASI_Rn02_00212588 predicted 861
4 SASI_Rn02_00212589 predicted 1036
5 SASI_Rn02_00212590 predicted 1075
6 SASI_Rn02_00212591 predicted 2185
7 SASI_Rn02_00212592 predicted 1470
8 SASI_Rn02_00212593 predicted 710
9 SASI_Rn02_00212594 predicted 2128
10 SASI_Rn02_00212595 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141679 predicted 311
2 SASI_Mm01_00141680 predicted 2225
3 SASI_Mm01_00141681 predicted 1468
4 SASI_Mm01_00141682 predicted 1357
5 SASI_Mm01_00141683 predicted 265
6 SASI_Mm01_00141685 predicted 981
7 SASI_Mm01_00141686 predicted 378
8 SASI_Mm01_00141687 predicted 1577
9 SASI_Mm01_00141688 predicted 1917
10 SASI_Mm02_00321436 predicted 1483
11 SASI_Mm01_00141684 predicted 2182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011786
ALOXE3 MISSION shRNA Bacterial Glycerol Stock
arachidonate lipoxygenase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011786.2-2344s21c1
Sequence:CCGGGGGTGAAAGCCGCTAACTAAACTCGAGTTTAGTTAGCGGCTTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-1472s21c1
Sequence:CCGGCCACTTCACCTACACGGATTTCTCGAGAAATCCGTGTAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-168s21c1
Sequence:CCGGGGATCGGTTCAGAAGTATAAGCTCGAGCTTATACTTCTGAACCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011786.1-2180s1c1
Sequence:CCGGCCCAGAGAAAGGAAGTTACAACTCGAGTTGTAACTTCCTTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-378s1c1
Sequence:CCGGGCAAGAACCATCTGTCAGGATCTCGAGATCCTGACAGATGGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-854s1c1
Sequence:CCGGCCAGTACCTGAATGGTGTCAACTCGAGTTGACACCATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1584s1c1
Sequence:CCGGGAGAGGTTTGTCTCAGAGATTCTCGAGAATCTCTGAGACAAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1232s1c1
Sequence:CCGGGCACGAGAACAACACGCATTTCTCGAGAAATGCGTGTTGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011786
ALOXE3 MISSION shRNA shRNA Plasmid DNA
arachidonate lipoxygenase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011786.2-2344s21c1
Sequence:CCGGGGGTGAAAGCCGCTAACTAAACTCGAGTTTAGTTAGCGGCTTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-1472s21c1
Sequence:CCGGCCACTTCACCTACACGGATTTCTCGAGAAATCCGTGTAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-168s21c1
Sequence:CCGGGGATCGGTTCAGAAGTATAAGCTCGAGCTTATACTTCTGAACCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011786.1-2180s1c1
Sequence:CCGGCCCAGAGAAAGGAAGTTACAACTCGAGTTGTAACTTCCTTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-378s1c1
Sequence:CCGGGCAAGAACCATCTGTCAGGATCTCGAGATCCTGACAGATGGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-854s1c1
Sequence:CCGGCCAGTACCTGAATGGTGTCAACTCGAGTTGACACCATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1584s1c1
Sequence:CCGGGAGAGGTTTGTCTCAGAGATTCTCGAGAATCTCTGAGACAAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1232s1c1
Sequence:CCGGGCACGAGAACAACACGCATTTCTCGAGAAATGCGTGTTGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011786
ALOXE3 MISSION shRNA Lentiviral Transduction Particles
arachidonate lipoxygenase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011786.2-2344s21c1
Sequence:CCGGGGGTGAAAGCCGCTAACTAAACTCGAGTTTAGTTAGCGGCTTTCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-1472s21c1
Sequence:CCGGCCACTTCACCTACACGGATTTCTCGAGAAATCCGTGTAGGTGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011786.2-168s21c1
Sequence:CCGGGGATCGGTTCAGAAGTATAAGCTCGAGCTTATACTTCTGAACCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011786.1-2180s1c1
Sequence:CCGGCCCAGAGAAAGGAAGTTACAACTCGAGTTGTAACTTCCTTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-378s1c1
Sequence:CCGGGCAAGAACCATCTGTCAGGATCTCGAGATCCTGACAGATGGTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-854s1c1
Sequence:CCGGCCAGTACCTGAATGGTGTCAACTCGAGTTGACACCATTCAGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1584s1c1
Sequence:CCGGGAGAGGTTTGTCTCAGAGATTCTCGAGAATCTCTGAGACAAACCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011786.1-1232s1c1
Sequence:CCGGGCACGAGAACAACACGCATTTCTCGAGAAATGCGTGTTGTTCTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021628
ALOXE3 MISSION shRNA Bacterial Glycerol Stock
arachidonate lipoxygenase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021628.2-2726s21c1
Sequence:CCGGACCAAAGTCCAATGCACAATACTCGAGTATTGTGCATTGGACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021628.2-1200s21c1
Sequence:CCGGAGTACCTGAATGGTGTCAATCCTCGAGGATTGACACCATTCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-2227s1c1
Sequence:CCGGCCTCACTGCAATCATCTTCAACTCGAGTTGAAGATGATTGCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1720s1c1
Sequence:CCGGGCACTTTCTGTGCACGCATTTCTCGAGAAATGCGTGCACAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1945s1c1
Sequence:CCGGCCACTTCACCTACACCAATTTCTCGAGAAATTGGTGTAGGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1014s1c1
Sequence:CCGGCCTTGACAAAGACGACAACTTCTCGAGAAGTTGTCGTCTTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1297s1c1
Sequence:CCGGGCACTGGTGTGAAGATCACTTCTCGAGAAGTGATCTTCACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021628
ALOXE3 MISSION shRNA shRNA Plasmid DNA
arachidonate lipoxygenase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021628.2-2726s21c1
Sequence:CCGGACCAAAGTCCAATGCACAATACTCGAGTATTGTGCATTGGACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021628.2-1200s21c1
Sequence:CCGGAGTACCTGAATGGTGTCAATCCTCGAGGATTGACACCATTCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-2227s1c1
Sequence:CCGGCCTCACTGCAATCATCTTCAACTCGAGTTGAAGATGATTGCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1720s1c1
Sequence:CCGGGCACTTTCTGTGCACGCATTTCTCGAGAAATGCGTGCACAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1945s1c1
Sequence:CCGGCCACTTCACCTACACCAATTTCTCGAGAAATTGGTGTAGGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1014s1c1
Sequence:CCGGCCTTGACAAAGACGACAACTTCTCGAGAAGTTGTCGTCTTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1297s1c1
Sequence:CCGGGCACTGGTGTGAAGATCACTTCTCGAGAAGTGATCTTCACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021628
ALOXE3 MISSION shRNA Lentiviral Transduction Particles
arachidonate lipoxygenase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021628.2-2726s21c1
Sequence:CCGGACCAAAGTCCAATGCACAATACTCGAGTATTGTGCATTGGACTTTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021628.2-1200s21c1
Sequence:CCGGAGTACCTGAATGGTGTCAATCCTCGAGGATTGACACCATTCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-2227s1c1
Sequence:CCGGCCTCACTGCAATCATCTTCAACTCGAGTTGAAGATGATTGCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1720s1c1
Sequence:CCGGGCACTTTCTGTGCACGCATTTCTCGAGAAATGCGTGCACAGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1945s1c1
Sequence:CCGGCCACTTCACCTACACCAATTTCTCGAGAAATTGGTGTAGGTGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1014s1c1
Sequence:CCGGCCTTGACAAAGACGACAACTTCTCGAGAAGTTGTCGTCTTTGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021628.1-1297s1c1
Sequence:CCGGGCACTGGTGTGAAGATCACTTCTCGAGAAGTGATCTTCACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks