EMAIL THIS PAGE TO A FRIEND

ALPI

alkaline phosphatase, intestinal

Synonyms: IAP
UniProtKB ID: P09923, B2R7Y4, Q53S80, Q9UBV5, Q9UCL2
Gene ID:
Human(248) Summary: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is upregulated during small intestinal epithelial cell differentiation. [provided by RefSeq, Jul 2008]
Mouse(76768) alkaline phosphatase, intestinal
Rat(24197) alkaline phosphatase, intestinal
chicken(424936) alkaline phosphatase, intestinal
domestic cat(101083873) alkaline phosphatase, intestinal
cow(280993) alkaline phosphatase, intestinal
naked mole-rat(101697469) alkaline phosphatase, intestinal
domestic guinea pig(100724954) alkaline phosphatase, intestinal
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001631 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001631 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001631 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001631 Rosetta Predictions human pricing
NM_022665 Rosetta Predictions rat pricing
NM_001081082 Rosetta Predictions mouse pricing
XM_129951 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332212 predicted 2003
2 SASI_Hs01_00235666 predicted 1041
3 SASI_Hs01_00235667 predicted 1196
4 SASI_Hs01_00235668 predicted 371
5 SASI_Hs01_00235669 predicted 1073
6 SASI_Hs01_00235670 predicted 1286
7 SASI_Hs02_00332213 predicted 368
8 SASI_Hs02_00332214 predicted 1108
9 SASI_Hs01_00235672 predicted 1930
10 SASI_Hs02_00332215 predicted 1768
11 SASI_Hs01_00235671 predicted 1086
12 SASI_Hs01_00235673 predicted 772
13 SASI_Hs01_00235674 predicted 2108
14 SASI_Hs01_00235675 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263429 predicted 1032
2 SASI_Rn02_00263430 predicted 895
3 SASI_Rn01_00120933 predicted 916
4 SASI_Rn01_00120934 predicted 582
5 SASI_Rn01_00120936 predicted 920
6 SASI_Rn02_00263431 predicted 1329
7 SASI_Rn01_00120940 predicted 1739
8 SASI_Rn01_00120941 predicted 828
9 SASI_Rn01_00120942 predicted 1567
10 SASI_Rn02_00263432 predicted 1010
11 SASI_Rn01_00120935 predicted 491
12 SASI_Rn01_00120937 predicted 1423
13 SASI_Rn01_00120938 predicted 326
14 SASI_Rn01_00120939 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295001 predicted 1163
2 SASI_Mm02_00295002 predicted 1065
3 SASI_Mm02_00295003 predicted 947
4 SASI_Mm02_00295004 predicted 1216
5 SASI_Mm02_00295005 predicted 624
6 SASI_Mm02_00295006 predicted 1267
7 SASI_Mm02_00295007 predicted 367
8 SASI_Mm02_00295008 predicted 1808
9 SASI_Mm02_00295009 predicted 940
10 SASI_Mm02_00295010 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254591 predicted 463
2 SASI_Mm01_00254592 predicted 615
3 SASI_Mm01_00254593 predicted 623
4 SASI_Mm01_00254594 predicted 621
5 SASI_Mm01_00254595 predicted 466
6 SASI_Mm01_00254596 predicted 617
7 SASI_Mm01_00254597 predicted 464
8 SASI_Mm01_00254598 predicted 538
9 SASI_Mm01_00254599 predicted 378
10 SASI_Mm01_00254600 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001631
ALPI MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, intestinal
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-915s1c1
Sequence:CCGGCGGAGACACGAAATATGAGATCTCGAGATCTCATATTTCGTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1266s1c1
Sequence:CCGGCACGTCCATCCTGTACGGCAACTCGAGTTGCCGTACAGGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1467s1c1
Sequence:CCGGGAGCTTCGTAGCGCATGTCATCTCGAGATGACATGCGCTACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1291s1c1
Sequence:CCGGCCGGGCTACGTGTTCAACTCACTCGAGTGAGTTGAACACGTAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-603s1c1
Sequence:CCGGCTGGTACTCAGATGCTGACATCTCGAGATGTCAGCATCTGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-2092s21c1
Sequence:CCGGCCCACCGTCTTAGCTTCAATCCTCGAGGATTGAAGCTAAGACGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-942s21c1
Sequence:CCGGGAGCCCGGAGACACGAAATATCTCGAGATATTTCGTGTCTCCGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-282s21c1
Sequence:CCGGACAGCCACCAGGATCCTAAAGCTCGAGCTTTAGGATCCTGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-1771s21c1
Sequence:CCGGACCTTCACCTCCTAGAGATAACTCGAGTTATCTCTAGGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001631
ALPI MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, intestinal
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-915s1c1
Sequence:CCGGCGGAGACACGAAATATGAGATCTCGAGATCTCATATTTCGTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1266s1c1
Sequence:CCGGCACGTCCATCCTGTACGGCAACTCGAGTTGCCGTACAGGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1467s1c1
Sequence:CCGGGAGCTTCGTAGCGCATGTCATCTCGAGATGACATGCGCTACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1291s1c1
Sequence:CCGGCCGGGCTACGTGTTCAACTCACTCGAGTGAGTTGAACACGTAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-603s1c1
Sequence:CCGGCTGGTACTCAGATGCTGACATCTCGAGATGTCAGCATCTGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-2092s21c1
Sequence:CCGGCCCACCGTCTTAGCTTCAATCCTCGAGGATTGAAGCTAAGACGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-942s21c1
Sequence:CCGGGAGCCCGGAGACACGAAATATCTCGAGATATTTCGTGTCTCCGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-282s21c1
Sequence:CCGGACAGCCACCAGGATCCTAAAGCTCGAGCTTTAGGATCCTGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-1771s21c1
Sequence:CCGGACCTTCACCTCCTAGAGATAACTCGAGTTATCTCTAGGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001631
ALPI MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, intestinal
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-915s1c1
Sequence:CCGGCGGAGACACGAAATATGAGATCTCGAGATCTCATATTTCGTGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1266s1c1
Sequence:CCGGCACGTCCATCCTGTACGGCAACTCGAGTTGCCGTACAGGATGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1467s1c1
Sequence:CCGGGAGCTTCGTAGCGCATGTCATCTCGAGATGACATGCGCTACGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-1291s1c1
Sequence:CCGGCCGGGCTACGTGTTCAACTCACTCGAGTGAGTTGAACACGTAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001631.2-603s1c1
Sequence:CCGGCTGGTACTCAGATGCTGACATCTCGAGATGTCAGCATCTGAGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-2092s21c1
Sequence:CCGGCCCACCGTCTTAGCTTCAATCCTCGAGGATTGAAGCTAAGACGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-942s21c1
Sequence:CCGGGAGCCCGGAGACACGAAATATCTCGAGATATTTCGTGTCTCCGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001631.3-282s21c1
Sequence:CCGGACAGCCACCAGGATCCTAAAGCTCGAGCTTTAGGATCCTGGTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001631.3-1771s21c1
Sequence:CCGGACCTTCACCTCCTAGAGATAACTCGAGTTATCTCTAGGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129951
ALPI MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, intestinal
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129951.4-1743s1c1
Sequence:CCGGCCATAGATTTCCTGAGCCCAACTCGAGTTGGGCTCAGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-45s1c1
Sequence:CCGGCCATCTGTCCTTTGGTATCATCTCGAGATGATACCAAAGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-861s1c1
Sequence:CCGGCCTCTTTGAGCCAACAGAAATCTCGAGATTTCTGTTGGCTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-967s1c1
Sequence:CCGGCCACAAGGCTTCTACCTCTTTCTCGAGAAAGAGGTAGAAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-1213s1c1
Sequence:CCGGGACAAATCCTACACCTCCATTCTCGAGAATGGAGGTGTAGGATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129951
ALPI MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, intestinal
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129951.4-1743s1c1
Sequence:CCGGCCATAGATTTCCTGAGCCCAACTCGAGTTGGGCTCAGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-45s1c1
Sequence:CCGGCCATCTGTCCTTTGGTATCATCTCGAGATGATACCAAAGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-861s1c1
Sequence:CCGGCCTCTTTGAGCCAACAGAAATCTCGAGATTTCTGTTGGCTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-967s1c1
Sequence:CCGGCCACAAGGCTTCTACCTCTTTCTCGAGAAAGAGGTAGAAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-1213s1c1
Sequence:CCGGGACAAATCCTACACCTCCATTCTCGAGAATGGAGGTGTAGGATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129951
ALPI MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, intestinal
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129951.4-1743s1c1
Sequence:CCGGCCATAGATTTCCTGAGCCCAACTCGAGTTGGGCTCAGGAAATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-45s1c1
Sequence:CCGGCCATCTGTCCTTTGGTATCATCTCGAGATGATACCAAAGGACAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-861s1c1
Sequence:CCGGCCTCTTTGAGCCAACAGAAATCTCGAGATTTCTGTTGGCTCAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-967s1c1
Sequence:CCGGCCACAAGGCTTCTACCTCTTTCTCGAGAAAGAGGTAGAAGCCTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129951.4-1213s1c1
Sequence:CCGGGACAAATCCTACACCTCCATTCTCGAGAATGGAGGTGTAGGATTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks