EMAIL THIS PAGE TO A FRIEND

ALPK1

alpha-kinase 1

164 Gene Product Result for
Synonyms: 8430410J10Rik LAK
Gene ID:
Human(80216) Summary: This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(71481) alpha-kinase 1
Rat(310879) alpha-kinase 1
chicken(100858173) alpha-kinase 1
dog(487906) alpha-kinase 1
Horse(100072711) alpha-kinase 1
cow(524375) alpha-kinase 1
domestic cat(101084874) alpha-kinase 1
naked mole-rat(101725390) alpha-kinase 1
sheep(101119049) alpha-kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025144 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025144 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025144 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027808 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027808 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027808 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_131194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_131194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_131194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102406 Rosetta Predictions human pricing
NM_025144 Rosetta Predictions human pricing
XM_001076258 Rosetta Predictions rat pricing
XM_227715 Rosetta Predictions rat pricing
XM_001479503 Rosetta Predictions mouse pricing
XM_001481048 Rosetta Predictions mouse pricing
XM_131194 Rosetta Predictions mouse pricing
XM_894534 Rosetta Predictions mouse pricing
XM_901632 Rosetta Predictions mouse pricing
XM_924200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323103 predicted 1797
2 SASI_Hs02_00323104 predicted 3492
3 SASI_Hs02_00323105 predicted 1121
4 SASI_Hs02_00323106 predicted 3683
5 SASI_Hs02_00323107 predicted 943
6 SASI_Hs02_00323108 predicted 1593
7 SASI_Hs02_00323109 predicted 3753
8 SASI_Hs02_00323110 predicted 494
9 SASI_Hs02_00323111 predicted 2601
10 SASI_Hs02_00323112 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357870 predicted 1847
2 SASI_Hs01_00077229 predicted 3540
3 SASI_Hs01_00077230 predicted 1175
4 SASI_Hs01_00077231 predicted 3735
5 SASI_Hs01_00077232 predicted 989
6 SASI_Hs01_00077233 predicted 1647
7 SASI_Hs02_00357871 predicted 3797
8 SASI_Hs02_00357872 predicted 545
9 SASI_Hs01_00077236 predicted 2655
10 SASI_Hs01_00077237 predicted 770
11 SASI_Hs01_00077228 predicted 1707
12 SASI_Hs01_00077234 predicted 2257
13 SASI_Hs01_00077235 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352590 predicted 3464
2 SASI_Rn02_00352591 predicted 623
3 SASI_Rn02_00352592 predicted 2584
4 SASI_Rn02_00352593 predicted 3671
5 SASI_Rn02_00352594 predicted 3619
6 SASI_Rn02_00352595 predicted 1850
7 SASI_Rn02_00352596 predicted 898
8 SASI_Rn02_00352597 predicted 1898
9 SASI_Rn02_00352598 predicted 1834
10 SASI_Rn02_00352599 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384655 predicted 3467
2 SASI_Rn02_00384656 predicted 622
3 SASI_Rn02_00384657 predicted 2583
4 SASI_Rn02_00384658 predicted 3676
5 SASI_Rn02_00384659 predicted 3626
6 SASI_Rn02_00384660 predicted 1849
7 SASI_Rn02_00384661 predicted 897
8 SASI_Rn02_00384662 predicted 1890
9 SASI_Rn02_00384663 predicted 1835
10 SASI_Rn02_00384664 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00410454 predicted 2420
2 SASI_Mm02_00410455 predicted 1717
3 SASI_Mm02_00410456 predicted 3004
4 SASI_Mm02_00410457 predicted 3799
5 SASI_Mm02_00410458 predicted 2635
6 SASI_Mm02_00410459 predicted 3836
7 SASI_Mm02_00410460 predicted 2982
8 SASI_Mm02_00410461 predicted 1311
9 SASI_Mm02_00410462 predicted 1909
10 SASI_Mm02_00410463 predicted 3791
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00421633 predicted 5255
2 SASI_Mm02_00421634 predicted 5225
3 SASI_Mm02_00421635 predicted 5236
4 SASI_Mm02_00421636 predicted 5224
5 SASI_Mm02_00421637 predicted 5244
6 SASI_Mm02_00421638 predicted 5233
7 SASI_Mm02_00421639 predicted 5208
8 SASI_Mm02_00421640 predicted 5149
9 SASI_Mm02_00421641 predicted 5236
10 SASI_Mm02_00421642 predicted 5249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256239 predicted 533
2 SASI_Mm01_00256240 predicted 471
3 SASI_Mm01_00256241 predicted 519
4 SASI_Mm01_00256242 predicted 568
5 SASI_Mm01_00256243 predicted 513
6 SASI_Mm01_00256244 predicted 511
7 SASI_Mm01_00256245 predicted 506
8 SASI_Mm01_00256246 predicted 574
9 SASI_Mm01_00256247 predicted 486
10 SASI_Mm01_00256248 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260027 predicted 627
2 SASI_Mm01_00260028 predicted 468
3 SASI_Mm01_00260029 predicted 435
4 SASI_Mm01_00260030 predicted 436
5 SASI_Mm01_00260032 predicted 554
6 SASI_Mm01_00260033 predicted 498
7 SASI_Mm01_00260034 predicted 495
8 SASI_Mm01_00260035 predicted 443
9 SASI_Mm02_00429507 predicted 465
10 SASI_Mm01_00260026 predicted 469
11 SASI_Mm01_00260031 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00286043 predicted 807
2 SASI_Mm01_00286044 predicted 917
3 SASI_Mm01_00286045 predicted 923
4 SASI_Mm01_00286046 predicted 774
5 SASI_Mm01_00286047 predicted 945
6 SASI_Mm01_00286048 predicted 505
7 SASI_Mm01_00286049 predicted 662
8 SASI_Mm01_00286050 predicted 739
9 SASI_Mm01_00286051 predicted 464
10 SASI_Mm01_00286052 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_924200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444069 predicted 4193
2 SASI_Mm02_00444070 predicted 3483
3 SASI_Mm02_00444071 predicted 4768
4 SASI_Mm02_00444072 predicted 5814
5 SASI_Mm02_00444073 predicted 5566
6 SASI_Mm02_00444074 predicted 5951
7 SASI_Mm02_00444075 predicted 5603
8 SASI_Mm02_00444076 predicted 3083
9 SASI_Mm02_00444077 predicted 3671
10 SASI_Mm02_00444078 predicted 5753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025144
ALPK1 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-1588s21c1
Sequence:CCGGTTCGAGTGCAGGTTGGATAAACTCGAGTTTATCCAACCTGCACTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-933s21c1
Sequence:CCGGGGCCTCCATTGTAGGATATTTCTCGAGAAATATCCTACAATGGAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3873s1c1
Sequence:CCGGGCCAATGATTTGCAAGAGGAACTCGAGTTCCTCTTGCAAATCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3885s1c1
Sequence:CCGGCAAGAGGAATTGATCAGTATCCTCGAGGATACTGATCAATTCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-1319s1c1
Sequence:CCGGGCCCAGGTGAAGGAACATTTACTCGAGTAAATGTTCCTTCACCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-2267s1c1
Sequence:CCGGCCCAAGAATATAGGCACACATCTCGAGATGTGTGCCTATATTCTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025144.2-4083s1c1
Sequence:CCGGGCATGTGTTGTTTAAGCCATTCTCGAGAATGGCTTAAACAACACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025144
ALPK1 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-1588s21c1
Sequence:CCGGTTCGAGTGCAGGTTGGATAAACTCGAGTTTATCCAACCTGCACTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-933s21c1
Sequence:CCGGGGCCTCCATTGTAGGATATTTCTCGAGAAATATCCTACAATGGAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3873s1c1
Sequence:CCGGGCCAATGATTTGCAAGAGGAACTCGAGTTCCTCTTGCAAATCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3885s1c1
Sequence:CCGGCAAGAGGAATTGATCAGTATCCTCGAGGATACTGATCAATTCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-1319s1c1
Sequence:CCGGGCCCAGGTGAAGGAACATTTACTCGAGTAAATGTTCCTTCACCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-2267s1c1
Sequence:CCGGCCCAAGAATATAGGCACACATCTCGAGATGTGTGCCTATATTCTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025144.2-4083s1c1
Sequence:CCGGGCATGTGTTGTTTAAGCCATTCTCGAGAATGGCTTAAACAACACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025144
ALPK1 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-1588s21c1
Sequence:CCGGTTCGAGTGCAGGTTGGATAAACTCGAGTTTATCCAACCTGCACTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025144.3-933s21c1
Sequence:CCGGGGCCTCCATTGTAGGATATTTCTCGAGAAATATCCTACAATGGAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3873s1c1
Sequence:CCGGGCCAATGATTTGCAAGAGGAACTCGAGTTCCTCTTGCAAATCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195267    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025144.2-3885s1c1
Sequence:CCGGCAAGAGGAATTGATCAGTATCCTCGAGGATACTGATCAATTCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-1319s1c1
Sequence:CCGGGCCCAGGTGAAGGAACATTTACTCGAGTAAATGTTCCTTCACCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025144.2-2267s1c1
Sequence:CCGGCCCAAGAATATAGGCACACATCTCGAGATGTGTGCCTATATTCTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025144.2-4083s1c1
Sequence:CCGGGCATGTGTTGTTTAAGCCATTCTCGAGAATGGCTTAAACAACACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027808
ALPK1 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027808.1-4236s21c1
Sequence:CCGGATGCAGAGCATATTGACATATCTCGAGATATGTCAATATGCTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3789s21c1
Sequence:CCGGTTTGGAAGACAGGACTATAAACTCGAGTTTATAGTCCTGTCTTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3846s21c1
Sequence:CCGGATTCGTCAAGTTATCCAATAACTCGAGTTATTGGATAACTTGACGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-2543s21c1
Sequence:CCGGCCGCTGAAGGATCTAGCAATACTCGAGTATTGCTAGATCCTTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027808
ALPK1 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027808.1-4236s21c1
Sequence:CCGGATGCAGAGCATATTGACATATCTCGAGATATGTCAATATGCTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3789s21c1
Sequence:CCGGTTTGGAAGACAGGACTATAAACTCGAGTTTATAGTCCTGTCTTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3846s21c1
Sequence:CCGGATTCGTCAAGTTATCCAATAACTCGAGTTATTGGATAACTTGACGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-2543s21c1
Sequence:CCGGCCGCTGAAGGATCTAGCAATACTCGAGTATTGCTAGATCCTTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027808
ALPK1 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027808.1-4236s21c1
Sequence:CCGGATGCAGAGCATATTGACATATCTCGAGATATGTCAATATGCTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3789s21c1
Sequence:CCGGTTTGGAAGACAGGACTATAAACTCGAGTTTATAGTCCTGTCTTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-3846s21c1
Sequence:CCGGATTCGTCAAGTTATCCAATAACTCGAGTTATTGGATAACTTGACGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027808.1-2543s21c1
Sequence:CCGGCCGCTGAAGGATCTAGCAATACTCGAGTATTGCTAGATCCTTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_131194
ALPK1 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-784s1c1
Sequence:CCGGCTCCGCTATTGTCTTCTTGATCTCGAGATCAAGAAGACAATAGCGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1019s1c1
Sequence:CCGGGAGAGTGACAAAGTCCTGGTACTCGAGTACCAGGACTTTGTCACTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-515s1c1
Sequence:CCGGCTGGATCGTCTCTTGTTGGAACTCGAGTTCCAACAAGAGACGATCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-541s1c1
Sequence:CCGGAGATGTGTCTACAGAGGACAACTCGAGTTGTCCTCTGTAGACACATCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1002s1c1
Sequence:CCGGCCTGGCTGTATAGGAATGAGACTCGAGTCTCATTCCTATACAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_131194
ALPK1 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-784s1c1
Sequence:CCGGCTCCGCTATTGTCTTCTTGATCTCGAGATCAAGAAGACAATAGCGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1019s1c1
Sequence:CCGGGAGAGTGACAAAGTCCTGGTACTCGAGTACCAGGACTTTGTCACTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-515s1c1
Sequence:CCGGCTGGATCGTCTCTTGTTGGAACTCGAGTTCCAACAAGAGACGATCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-541s1c1
Sequence:CCGGAGATGTGTCTACAGAGGACAACTCGAGTTGTCCTCTGTAGACACATCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1002s1c1
Sequence:CCGGCCTGGCTGTATAGGAATGAGACTCGAGTCTCATTCCTATACAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_131194
ALPK1 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-784s1c1
Sequence:CCGGCTCCGCTATTGTCTTCTTGATCTCGAGATCAAGAAGACAATAGCGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1019s1c1
Sequence:CCGGGAGAGTGACAAAGTCCTGGTACTCGAGTACCAGGACTTTGTCACTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-515s1c1
Sequence:CCGGCTGGATCGTCTCTTGTTGGAACTCGAGTTCCAACAAGAGACGATCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-541s1c1
Sequence:CCGGAGATGTGTCTACAGAGGACAACTCGAGTTGTCCTCTGTAGACACATCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_131194.2-1002s1c1
Sequence:CCGGCCTGGCTGTATAGGAATGAGACTCGAGTCTCATTCCTATACAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)