EMAIL THIS PAGE TO A FRIEND

ALPK2

alpha-kinase 2

131 Gene Product Result for
Synonyms: HAK
UniProtKB ID: Q86TB3, Q6ZUX0, Q8NAT5, Q96L95
Gene ID:
Mouse(225638) alpha-kinase 2
Rat(498875) alpha-kinase 2
sheep(101116008) alpha-kinase 2
naked mole-rat(101718161) alpha-kinase 2
Zebrafish(559835) alpha-kinase 2
domestic cat(101088624) alpha-kinase 2
cow(510218) alpha-kinase 2
Horse(100054491) alpha-kinase 2
dog(483966) alpha-kinase 2
chicken(426853) alpha-kinase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001037294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001037294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001037294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052947 Rosetta Predictions human pricing
XM_574162 Rosetta Predictions rat pricing
XR_008175 Rosetta Predictions rat pricing
XM_001002606 Rosetta Predictions mouse pricing
XM_001002615 Rosetta Predictions mouse pricing
XM_914598 Rosetta Predictions mouse pricing
XM_985897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361738 predicted 744
2 SASI_Hs01_00142601 predicted 1031
3 SASI_Hs02_00361739 predicted 6172
4 SASI_Hs01_00142604 predicted 4840
5 SASI_Hs02_00361740 predicted 750
6 SASI_Hs01_00142605 predicted 6264
7 SASI_Hs01_00142606 predicted 5019
8 SASI_Hs01_00142608 predicted 4431
9 SASI_Hs02_00361741 predicted 3559
10 SASI_Hs02_00361742 predicted 3179
11 SASI_Hs01_00142602 predicted 3980
12 SASI_Hs01_00142603 predicted 1507
13 SASI_Hs01_00142607 predicted 392
14 SASI_Hs01_00142609 predicted 1191
15 SASI_Hs01_00142610 predicted 4554
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401495 predicted 559
2 SASI_Rn02_00401496 predicted 424
3 SASI_Rn02_00401497 predicted 520
4 SASI_Rn02_00401498 predicted 540
5 SASI_Rn02_00401499 predicted 523
6 SASI_Rn02_00401500 predicted 555
7 SASI_Rn02_00401501 predicted 293
8 SASI_Rn02_00401502 predicted 447
9 SASI_Rn02_00401503 predicted 811
10 SASI_Rn02_00401504 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00416397 predicted 4229
2 SASI_Rn02_00416398 predicted 4205
3 SASI_Rn02_00416399 predicted 4675
4 SASI_Rn02_00416400 predicted 4260
5 SASI_Rn02_00416401 predicted 4611
6 SASI_Rn02_00416402 predicted 4209
7 SASI_Rn02_00416403 predicted 4186
8 SASI_Rn02_00416404 predicted 4702
9 SASI_Rn02_00416405 predicted 4732
10 SASI_Rn02_00416406 predicted 4464
11 SASI_Rn01_00152495 predicted 562
12 SASI_Rn01_00152496 predicted 3576
13 SASI_Rn01_00152497 predicted 1412
14 SASI_Rn01_00152498 predicted 3473
15 SASI_Rn01_00152499 predicted 1989
16 SASI_Rn01_00152500 predicted 1045
17 SASI_Rn01_00152501 predicted 422
18 SASI_Rn01_00152502 predicted 2326
19 SASI_Rn01_00152503 predicted 814
20 SASI_Rn01_00152504 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245433 predicted 4175
2 SASI_Mm01_00245434 predicted 3236
3 SASI_Mm01_00245435 predicted 3459
4 SASI_Mm01_00245437 predicted 4078
5 SASI_Mm01_00245438 predicted 4087
6 SASI_Mm02_00355538 predicted 3960
7 SASI_Mm02_00355539 predicted 3411
8 SASI_Mm02_00355540 predicted 4157
9 SASI_Mm02_00355541 predicted 4163
10 SASI_Mm01_00245439 predicted 4028
11 SASI_Mm01_00245436 predicted 3174
12 SASI_Mm01_00245440 predicted 3314
13 SASI_Mm01_00245441 predicted 2153
14 SASI_Mm01_00245442 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261288 predicted 4180
2 SASI_Mm02_00355542 predicted 4812
3 SASI_Mm01_00261290 predicted 3458
4 SASI_Mm02_00355543 predicted 3023
5 SASI_Mm02_00355544 predicted 3805
6 SASI_Mm02_00355545 predicted 2553
7 SASI_Mm02_00355546 predicted 654
8 SASI_Mm02_00355547 predicted 766
9 SASI_Mm02_00355548 predicted 3779
10 SASI_Mm02_00355549 predicted 743
11 SASI_Mm01_00261289 predicted 3246
12 SASI_Mm01_00261291 predicted 3184
13 SASI_Mm01_00261292 predicted 4084
14 SASI_Mm01_00261293 predicted 4092
15 SASI_Mm01_00261294 predicted 4038
16 SASI_Mm01_00261295 predicted 3307
17 SASI_Mm01_00261296 predicted 2160
18 SASI_Mm01_00261297 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438710 predicted 4178
2 SASI_Mm02_00438711 predicted 4812
3 SASI_Mm02_00438712 predicted 3453
4 SASI_Mm02_00438713 predicted 3024
5 SASI_Mm02_00438714 predicted 3801
6 SASI_Mm02_00438715 predicted 2559
7 SASI_Mm02_00438716 predicted 654
8 SASI_Mm02_00438717 predicted 3775
9 SASI_Mm02_00438718 predicted 743
10 SASI_Mm02_00438719 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00448928 predicted 4179
2 SASI_Mm02_00448929 predicted 3457
3 SASI_Mm02_00448930 predicted 3026
4 SASI_Mm02_00448931 predicted 3805
5 SASI_Mm02_00448932 predicted 2560
6 SASI_Mm02_00448933 predicted 658
7 SASI_Mm02_00448934 predicted 3776
8 SASI_Mm02_00448935 predicted 741
9 SASI_Mm02_00448936 predicted 1637
10 SASI_Mm02_00448937 predicted 1691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128981
ALPK2 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-3316s1c1
Sequence:CCGGCCTAAGTTTGAAAGGTCCTTACTCGAGTAAGGACCTTTCAAACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-1571s1c1
Sequence:CCGGCCAGGGAAGAAATTGAGTGTACTCGAGTACACTCAATTTCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2762s1c1
Sequence:CCGGCCCGTCAAAGTGTAATTCCTACTCGAGTAGGAATTACACTTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2312s1c1
Sequence:CCGGCCAGCGTAGAAGGAAACGAATCTCGAGATTCGTTTCCTTCTACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-838s1c1
Sequence:CCGGCCCTACAGTGAAAGAGGGTTTCTCGAGAAACCCTCTTTCACTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128981
ALPK2 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-3316s1c1
Sequence:CCGGCCTAAGTTTGAAAGGTCCTTACTCGAGTAAGGACCTTTCAAACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-1571s1c1
Sequence:CCGGCCAGGGAAGAAATTGAGTGTACTCGAGTACACTCAATTTCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2762s1c1
Sequence:CCGGCCCGTCAAAGTGTAATTCCTACTCGAGTAGGAATTACACTTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2312s1c1
Sequence:CCGGCCAGCGTAGAAGGAAACGAATCTCGAGATTCGTTTCCTTCTACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-838s1c1
Sequence:CCGGCCCTACAGTGAAAGAGGGTTTCTCGAGAAACCCTCTTTCACTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128981
ALPK2 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-3316s1c1
Sequence:CCGGCCTAAGTTTGAAAGGTCCTTACTCGAGTAAGGACCTTTCAAACTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-1571s1c1
Sequence:CCGGCCAGGGAAGAAATTGAGTGTACTCGAGTACACTCAATTTCTTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2762s1c1
Sequence:CCGGCCCGTCAAAGTGTAATTCCTACTCGAGTAGGAATTACACTTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-2312s1c1
Sequence:CCGGCCAGCGTAGAAGGAAACGAATCTCGAGATTCGTTTCCTTCTACGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128981.2-838s1c1
Sequence:CCGGCCCTACAGTGAAAGAGGGTTTCTCGAGAAACCCTCTTTCACTGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052947
VALIDATED
ALPK2 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.1-4342s1c1
Sequence:CCGGGCGAAGACCTTGGCATTTATTCTCGAGAATAAATGCCAAGGTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.1-5452s1c1
Sequence:CCGGCCTGAGAACAATATCCCGTATCTCGAGATACGGGATATTGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052947.1-6185s1c1
Sequence:CCGGCCTCACATCATGTGTATATTTCTCGAGAAATATACACATGATGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-224s1c1
Sequence:CCGGCTGAGGCAACTGCACACATTTCTCGAGAAATGTGTGCAGTTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-5416s1c1
Sequence:CCGGGTACCTGAGATCATTCCTATTCTCGAGAATAGGAATGATCTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2359s1c1
Sequence:CCGGCCAACAACATTAACTGCTAATCTCGAGATTAGCAGTTAATGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-1295s1c1
Sequence:CCGGGCATGCAAGTTAATACTCTATCTCGAGATAGAGTATTAACTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2743s1c1
Sequence:CCGGGCAGACTTTAGGAGCTATGAACTCGAGTTCATAGCTCCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-7002s21c1
Sequence:GTACCGGCAACCTCACATCATGTGTATACTCGAGTATACACATGATGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-5858s21c1
Sequence:CCGGTCAAGTCGCCAGGATACTAAACTCGAGTTTAGTATCCTGGCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-1217s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-368s21c1
Sequence:CCGGATCGATGGGAGTGGCATTATTCTCGAGAATAATGCCACTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052947.3-298s21c1
Sequence:CCGGCGCTGTGCTTCGCTGCATAATCTCGAGATTATGCAGCGAAGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052947
VALIDATED
ALPK2 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.1-4342s1c1
Sequence:CCGGGCGAAGACCTTGGCATTTATTCTCGAGAATAAATGCCAAGGTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.1-5452s1c1
Sequence:CCGGCCTGAGAACAATATCCCGTATCTCGAGATACGGGATATTGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052947.1-6185s1c1
Sequence:CCGGCCTCACATCATGTGTATATTTCTCGAGAAATATACACATGATGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-224s1c1
Sequence:CCGGCTGAGGCAACTGCACACATTTCTCGAGAAATGTGTGCAGTTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-5416s1c1
Sequence:CCGGGTACCTGAGATCATTCCTATTCTCGAGAATAGGAATGATCTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2359s1c1
Sequence:CCGGCCAACAACATTAACTGCTAATCTCGAGATTAGCAGTTAATGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-1295s1c1
Sequence:CCGGGCATGCAAGTTAATACTCTATCTCGAGATAGAGTATTAACTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2743s1c1
Sequence:CCGGGCAGACTTTAGGAGCTATGAACTCGAGTTCATAGCTCCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-7002s21c1
Sequence:GTACCGGCAACCTCACATCATGTGTATACTCGAGTATACACATGATGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-5858s21c1
Sequence:CCGGTCAAGTCGCCAGGATACTAAACTCGAGTTTAGTATCCTGGCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-1217s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-368s21c1
Sequence:CCGGATCGATGGGAGTGGCATTATTCTCGAGAATAATGCCACTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052947.3-298s21c1
Sequence:CCGGCGCTGTGCTTCGCTGCATAATCTCGAGATTATGCAGCGAAGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052947
VALIDATED
ALPK2 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.1-4342s1c1
Sequence:CCGGGCGAAGACCTTGGCATTTATTCTCGAGAATAAATGCCAAGGTCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.1-5452s1c1
Sequence:CCGGCCTGAGAACAATATCCCGTATCTCGAGATACGGGATATTGTTCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052947.1-6185s1c1
Sequence:CCGGCCTCACATCATGTGTATATTTCTCGAGAAATATACACATGATGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-224s1c1
Sequence:CCGGCTGAGGCAACTGCACACATTTCTCGAGAAATGTGTGCAGTTGCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-5416s1c1
Sequence:CCGGGTACCTGAGATCATTCCTATTCTCGAGAATAGGAATGATCTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2359s1c1
Sequence:CCGGCCAACAACATTAACTGCTAATCTCGAGATTAGCAGTTAATGTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052947.2-1295s1c1
Sequence:CCGGGCATGCAAGTTAATACTCTATCTCGAGATAGAGTATTAACTTGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_052947.2-2743s1c1
Sequence:CCGGGCAGACTTTAGGAGCTATGAACTCGAGTTCATAGCTCCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-7002s21c1
Sequence:GTACCGGCAACCTCACATCATGTGTATACTCGAGTATACACATGATGTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-5858s21c1
Sequence:CCGGTCAAGTCGCCAGGATACTAAACTCGAGTTTAGTATCCTGGCGACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-1217s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_052947.3-368s21c1
Sequence:CCGGATCGATGGGAGTGGCATTATTCTCGAGAATAATGCCACTCCCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052947.3-298s21c1
Sequence:CCGGCGCTGTGCTTCGCTGCATAATCTCGAGATTATGCAGCGAAGCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037294
ALPK2 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-5583s21c1
Sequence:CCGGTCCCGAGCACTCCGGAAATATCTCGAGATATTTCCGGAGTGCTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-3884s21c1
Sequence:CCGGGCGGCAAAGTGAAGATCATAACTCGAGTTATGATCTTCACTTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-732s21c1
Sequence:CCGGTGATTCCTTCCTCGACAAATTCTCGAGAATTTGTCGAGGAAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-1234s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037294
ALPK2 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-5583s21c1
Sequence:CCGGTCCCGAGCACTCCGGAAATATCTCGAGATATTTCCGGAGTGCTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-3884s21c1
Sequence:CCGGGCGGCAAAGTGAAGATCATAACTCGAGTTATGATCTTCACTTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-732s21c1
Sequence:CCGGTGATTCCTTCCTCGACAAATTCTCGAGAATTTGTCGAGGAAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-1234s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037294
ALPK2 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-5583s21c1
Sequence:CCGGTCCCGAGCACTCCGGAAATATCTCGAGATATTTCCGGAGTGCTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-3884s21c1
Sequence:CCGGGCGGCAAAGTGAAGATCATAACTCGAGTTATGATCTTCACTTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-732s21c1
Sequence:CCGGTGATTCCTTCCTCGACAAATTCTCGAGAATTTGTCGAGGAAGGAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037294.1-1234s21c1
Sequence:CCGGGTTATGACGGATTACTCTAATCTCGAGATTAGAGTAATCCGTCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks