EMAIL THIS PAGE TO A FRIEND

ALPK3

alpha-kinase 3

240 Gene Product Result for
Synonyms: MAK MIDORI
UniProtKB ID: Q96L96, Q9P2L6
Gene ID:
Mouse(116904) alpha-kinase 3
Rat(365298) alpha-kinase 3
chicken(768936) alpha-kinase 3
domestic cat(101086567) alpha-kinase 3
cow(516866) alpha-kinase 3
Horse(100068508) alpha-kinase 3
dog(479052) alpha-kinase 3
naked mole-rat(101724560) alpha-kinase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054085 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054085 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054085 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020778 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020778 Rosetta Predictions human pricing
XM_001066959 Rosetta Predictions rat pricing
XM_344916 Rosetta Predictions rat pricing
NM_054085 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080957 predicted 3085
2 SASI_Hs01_00080960 predicted 2503
3 SASI_Hs01_00080961 predicted 4973
4 SASI_Hs01_00080962 predicted 3105
5 SASI_Hs01_00080963 predicted 1760
6 SASI_Hs01_00080964 predicted 2513
7 SASI_Hs01_00080965 predicted 5525
8 SASI_Hs01_00080966 predicted 2264
9 SASI_Hs02_00353924 predicted 4858
10 SASI_Hs02_00353925 predicted 2468
11 SASI_Hs01_00080958 predicted 5550
12 SASI_Hs01_00080959 predicted 2229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319382 predicted 3734
2 SASI_Rn02_00319383 predicted 949
3 SASI_Rn02_00319384 predicted 3875
4 SASI_Rn02_00319385 predicted 2529
5 SASI_Rn02_00319386 predicted 227
6 SASI_Rn02_00319387 predicted 4322
7 SASI_Rn02_00319388 predicted 3809
8 SASI_Rn02_00319389 predicted 2414
9 SASI_Rn02_00319390 predicted 332
10 SASI_Rn02_00319391 predicted 2765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344916 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397756 predicted 3734
2 SASI_Rn02_00397757 predicted 951
3 SASI_Rn02_00397758 predicted 3876
4 SASI_Rn02_00397759 predicted 2527
5 SASI_Rn02_00397760 predicted 228
6 SASI_Rn02_00397761 predicted 4317
7 SASI_Rn02_00397762 predicted 3817
8 SASI_Rn02_00397763 predicted 2422
9 SASI_Rn02_00397764 predicted 338
10 SASI_Rn02_00397765 predicted 2769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054085 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109246 predicted 4334
2 SASI_Mm01_00109247 predicted 3238
3 SASI_Mm01_00109248 predicted 4683
4 SASI_Mm01_00109249 predicted 368
5 SASI_Mm01_00109250 predicted 1874
6 SASI_Mm01_00109251 predicted 4707
7 SASI_Mm01_00109252 predicted 4045
8 SASI_Mm01_00109253 predicted 4725
9 SASI_Mm01_00109254 predicted 4351
10 SASI_Mm01_00109255 predicted 5140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054085
ALPK3 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-3077s21c1
Sequence:CCGGGCGTGGAGAACAATCACTTAGCTCGAGCTAAGTGATTGTTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5324s21c1
Sequence:CCGGCTAGACCCTCATCTAAGTTTACTCGAGTAAACTTAGATGAGGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5196s21c1
Sequence:CCGGGGGACCTCTCTGAGTAGTTTCCTCGAGGAAACTACTCAGAGAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-356s21c1
Sequence:CCGGCCTGGTACAAGGATGACATAGCTCGAGCTATGTCATCCTTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4477s1c1
Sequence:CCGGCCTGCAAACAATATACCGTATCTCGAGATACGGTATATTGTTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1530s1c1
Sequence:CCGGGCCTTTGAACAGGAAGAGATTCTCGAGAATCTCTTCCTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-3070s1c1
Sequence:CCGGCGCGTGGAGAACAATCACTTACTCGAGTAAGTGATTGTTCTCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1586s1c1
Sequence:CCGGCCTCTCTCTCAAGTCAGACTTCTCGAGAAGTCTGACTTGAGAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4334s1c1
Sequence:CCGGGCAGAAACTATGACGTCACTACTCGAGTAGTGACGTCATAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054085
ALPK3 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-3077s21c1
Sequence:CCGGGCGTGGAGAACAATCACTTAGCTCGAGCTAAGTGATTGTTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5324s21c1
Sequence:CCGGCTAGACCCTCATCTAAGTTTACTCGAGTAAACTTAGATGAGGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5196s21c1
Sequence:CCGGGGGACCTCTCTGAGTAGTTTCCTCGAGGAAACTACTCAGAGAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-356s21c1
Sequence:CCGGCCTGGTACAAGGATGACATAGCTCGAGCTATGTCATCCTTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4477s1c1
Sequence:CCGGCCTGCAAACAATATACCGTATCTCGAGATACGGTATATTGTTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1530s1c1
Sequence:CCGGGCCTTTGAACAGGAAGAGATTCTCGAGAATCTCTTCCTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-3070s1c1
Sequence:CCGGCGCGTGGAGAACAATCACTTACTCGAGTAAGTGATTGTTCTCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1586s1c1
Sequence:CCGGCCTCTCTCTCAAGTCAGACTTCTCGAGAAGTCTGACTTGAGAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4334s1c1
Sequence:CCGGGCAGAAACTATGACGTCACTACTCGAGTAGTGACGTCATAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054085
ALPK3 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-3077s21c1
Sequence:CCGGGCGTGGAGAACAATCACTTAGCTCGAGCTAAGTGATTGTTCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5324s21c1
Sequence:CCGGCTAGACCCTCATCTAAGTTTACTCGAGTAAACTTAGATGAGGGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378454    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054085.2-5196s21c1
Sequence:CCGGGGGACCTCTCTGAGTAGTTTCCTCGAGGAAACTACTCAGAGAGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054085.2-356s21c1
Sequence:CCGGCCTGGTACAAGGATGACATAGCTCGAGCTATGTCATCCTTGTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4477s1c1
Sequence:CCGGCCTGCAAACAATATACCGTATCTCGAGATACGGTATATTGTTTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1530s1c1
Sequence:CCGGGCCTTTGAACAGGAAGAGATTCTCGAGAATCTCTTCCTGTTCAAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-3070s1c1
Sequence:CCGGCGCGTGGAGAACAATCACTTACTCGAGTAAGTGATTGTTCTCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-1586s1c1
Sequence:CCGGCCTCTCTCTCAAGTCAGACTTCTCGAGAAGTCTGACTTGAGAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054085.1-4334s1c1
Sequence:CCGGGCAGAAACTATGACGTCACTACTCGAGTAGTGACGTCATAGTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020778
ALPK3 MISSION shRNA Bacterial Glycerol Stock
alpha-kinase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.3-2509s1c1
Sequence:CCGGCCGGAAGTCAAGGTATCATTGCTCGAGCAATGATACCTTGACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020778.3-9519s1c1
Sequence:CCGGGCGACAGTGTACCGTTGATAACTCGAGTTATCAACGGTACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-5529s1c1
Sequence:CCGGGCTACCAAACTCCGAGGATACCTCGAGGTATCCTCGGAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-4593s1c1
Sequence:CCGGCCACAGGTGATCCGGAAGATTCTCGAGAATCTTCCGGATCACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-2001s1c1
Sequence:CCGGGAAGTGTATTTCTCCTTGAAGCTCGAGCTTCAAGGAGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-1004s1c1
Sequence:CCGGGCTATTTGAGACCACGCTCAACTCGAGTTGAGCGTGGTCTCAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020778.1-6164s1c1
Sequence:CCGGCCCTCCTTGAAGTTTACACTTCTCGAGAAGTGTAAACTTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-5300s1c1
Sequence:CCGGGCCTGCAAACAATATCCCATACTCGAGTATGGGATATTGTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-2799s1c1
Sequence:CCGGGCAGGTGAGAAGATACAGGAACTCGAGTTCCTGTATCTTCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-3638s1c1
Sequence:CCGGCCTCATAGATTCCCTGAAGAACTCGAGTTCTTCAGGGAATCTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020778
ALPK3 MISSION shRNA shRNA Plasmid DNA
alpha-kinase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.3-2509s1c1
Sequence:CCGGCCGGAAGTCAAGGTATCATTGCTCGAGCAATGATACCTTGACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020778.3-9519s1c1
Sequence:CCGGGCGACAGTGTACCGTTGATAACTCGAGTTATCAACGGTACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-5529s1c1
Sequence:CCGGGCTACCAAACTCCGAGGATACCTCGAGGTATCCTCGGAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-4593s1c1
Sequence:CCGGCCACAGGTGATCCGGAAGATTCTCGAGAATCTTCCGGATCACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-2001s1c1
Sequence:CCGGGAAGTGTATTTCTCCTTGAAGCTCGAGCTTCAAGGAGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-1004s1c1
Sequence:CCGGGCTATTTGAGACCACGCTCAACTCGAGTTGAGCGTGGTCTCAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020778.1-6164s1c1
Sequence:CCGGCCCTCCTTGAAGTTTACACTTCTCGAGAAGTGTAAACTTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-5300s1c1
Sequence:CCGGGCCTGCAAACAATATCCCATACTCGAGTATGGGATATTGTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-2799s1c1
Sequence:CCGGGCAGGTGAGAAGATACAGGAACTCGAGTTCCTGTATCTTCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-3638s1c1
Sequence:CCGGCCTCATAGATTCCCTGAAGAACTCGAGTTCTTCAGGGAATCTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020778
ALPK3 MISSION shRNA Lentiviral Transduction Particles
alpha-kinase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.3-2509s1c1
Sequence:CCGGCCGGAAGTCAAGGTATCATTGCTCGAGCAATGATACCTTGACTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219754    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020778.3-9519s1c1
Sequence:CCGGGCGACAGTGTACCGTTGATAACTCGAGTTATCAACGGTACACTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-5529s1c1
Sequence:CCGGGCTACCAAACTCCGAGGATACCTCGAGGTATCCTCGGAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-4593s1c1
Sequence:CCGGCCACAGGTGATCCGGAAGATTCTCGAGAATCTTCCGGATCACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020778.2-2001s1c1
Sequence:CCGGGAAGTGTATTTCTCCTTGAAGCTCGAGCTTCAAGGAGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-1004s1c1
Sequence:CCGGGCTATTTGAGACCACGCTCAACTCGAGTTGAGCGTGGTCTCAAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020778.1-6164s1c1
Sequence:CCGGCCCTCCTTGAAGTTTACACTTCTCGAGAAGTGTAAACTTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-5300s1c1
Sequence:CCGGGCCTGCAAACAATATCCCATACTCGAGTATGGGATATTGTTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-2799s1c1
Sequence:CCGGGCAGGTGAGAAGATACAGGAACTCGAGTTCCTGTATCTTCTCACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020778.1-3638s1c1
Sequence:CCGGCCTCATAGATTCCCTGAAGAACTCGAGTTCTTCAGGGAATCTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks