EMAIL THIS PAGE TO A FRIEND

ALPL

alkaline phosphatase, liver/bone/kidney

108 Gene Product Result for
Synonyms: AP-TNAP APTNAP HOPS TNAP TNSALP
Gene ID:
Human(249) Summary: There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the tissue non-specific form is located on chromosome 1. The product of this gene is a membrane bound glycosylated enzyme that is not expressed in any particular tissue and is, therefore, referred to as the tissue-nonspecific form of the enzyme. The exact physiological function of the alkaline phosphatases is not known. A proposed function of this form of the enzyme is matrix mineralization; however, mice that lack a functional form of this enzyme show normal skeletal development. This enzyme has been linked directly to hypophosphatasia, a disorder that is characterized by hypercalcemia and includes skeletal defects. The character of this disorder can vary, however, depending on the specific mutation since this determines age of onset and severity of symptoms. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Mouse(11647) alkaline phosphatase, liver/bone/kidney
Rat(25586) alkaline phosphatase, liver/bone/kidney
Zebrafish(393982) alkaline phosphatase, liver/bone/kidney
domestic cat(727689) alkaline phosphatase, liver/bone/kidney
dog(403548) alkaline phosphatase, liver/bone/kidney
chicken(396317) alkaline phosphatase, liver/bone/kidney
cow(280994) alkaline phosphatase, liver/bone/kidney
naked mole-rat(101725910) alkaline phosphatase, liver/bone/kidney
domestic guinea pig(100718683) alkaline phosphatase, liver/bone/kidney
sheep(101123195) alkaline phosphatase, liver/bone/kidney
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
381551 7-Isopropoxy-3-phenyl-4H-1-benzopyran-4-one 97% rat pricing

Kits

Product # Description Species Add to Cart
 
APF Alkaline Phosphatase Detection Kit, Fluorescence human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000478 siRNAs that have been validated in the lab human pricing
NM_001127501 Rosetta Predictions human pricing
NM_013059 Rosetta Predictions rat pricing
NM_007431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000478 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013331 validated 1531
2 SASI_Hs01_00013333 predicted 846
3 SASI_Hs02_00302620 predicted 731
4 SASI_Hs02_00302621 predicted 1486
5 SASI_Hs01_00013334 predicted 1195
6 SASI_Hs01_00013335 predicted 1286
7 SASI_Hs01_00013336 predicted 2250
8 SASI_Hs01_00013337 predicted 952
9 SASI_Hs01_00013339 predicted 655
10 SASI_Hs01_00013340 predicted 1357
11 SASI_Hs01_00013332 predicted 286
12 SASI_Hs01_00013338 predicted 1335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329704 predicted 1497
2 SASI_Hs02_00329705 predicted 810
3 SASI_Hs02_00329706 predicted 701
4 SASI_Hs02_00329707 predicted 1444
5 SASI_Hs02_00329708 predicted 1162
6 SASI_Hs02_00329709 predicted 1250
7 SASI_Hs02_00329710 predicted 2212
8 SASI_Hs02_00329711 predicted 921
9 SASI_Hs02_00329712 predicted 619
10 SASI_Hs02_00329713 predicted 1326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101735 predicted 762
2 SASI_Rn01_00101737 predicted 1111
3 SASI_Rn01_00101738 predicted 299
4 SASI_Rn01_00101739 predicted 1154
5 SASI_Rn02_00260795 predicted 1527
6 SASI_Rn01_00101740 predicted 942
7 SASI_Rn01_00101741 predicted 329
8 SASI_Rn02_00260796 predicted 1405
9 SASI_Rn01_00101742 predicted 1032
10 SASI_Rn01_00101743 predicted 377
11 SASI_Rn01_00101736 predicted 227
12 SASI_Rn01_00101744 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050645 predicted 1902
2 SASI_Mm01_00050646 predicted 844
3 SASI_Mm01_00050647 predicted 919
4 SASI_Mm01_00050648 predicted 1233
5 SASI_Mm01_00050649 predicted 988
6 SASI_Mm01_00050650 predicted 658
7 SASI_Mm02_00311589 predicted 894
8 SASI_Mm01_00050651 predicted 1026
9 SASI_Mm01_00050653 predicted 1020
10 SASI_Mm01_00050654 predicted 1119
11 SASI_Mm01_00050652 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000478
ALPL MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, liver/bone/kidney
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1085s1c1
Sequence:CCGGCCCACAATGTGGACTACCTATCTCGAGATAGGTAGTCCACATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-343s1c1
Sequence:CCGGGCGCAAGAGACACTGAAATATCTCGAGATATTTCAGTGTCTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1477s1c1
Sequence:CCGGACTGCCATCCTGTATGGCAATCTCGAGATTGCCATACAGGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1014s1c1
Sequence:CCGGGAAGAGCTTCAAACCGAGATACTCGAGTATCTCGGTTTGAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-393s1c1
Sequence:CCGGCGTGGCTAAGAATGTCATCATCTCGAGATGATGACATTCTTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2057s21c1
Sequence:CCGGTTTGGCCAACAGGGTAGATTTCTCGAGAAATCTACCCTGTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-1546s21c1
Sequence:CCGGATGTCTCCATGGTGGACTATGCTCGAGCATAGTCCACCATGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2110s21c1
Sequence:CCGGCATTCTCAAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-961s21c1
Sequence:CCGGAGTATGAGAGTGACGAGAAAGCTCGAGCTTTCTCGTCACTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000478
ALPL MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, liver/bone/kidney
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1085s1c1
Sequence:CCGGCCCACAATGTGGACTACCTATCTCGAGATAGGTAGTCCACATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-343s1c1
Sequence:CCGGGCGCAAGAGACACTGAAATATCTCGAGATATTTCAGTGTCTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1477s1c1
Sequence:CCGGACTGCCATCCTGTATGGCAATCTCGAGATTGCCATACAGGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1014s1c1
Sequence:CCGGGAAGAGCTTCAAACCGAGATACTCGAGTATCTCGGTTTGAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-393s1c1
Sequence:CCGGCGTGGCTAAGAATGTCATCATCTCGAGATGATGACATTCTTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2057s21c1
Sequence:CCGGTTTGGCCAACAGGGTAGATTTCTCGAGAAATCTACCCTGTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-1546s21c1
Sequence:CCGGATGTCTCCATGGTGGACTATGCTCGAGCATAGTCCACCATGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2110s21c1
Sequence:CCGGCATTCTCAAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-961s21c1
Sequence:CCGGAGTATGAGAGTGACGAGAAAGCTCGAGCTTTCTCGTCACTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000478
ALPL MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, liver/bone/kidney
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1085s1c1
Sequence:CCGGCCCACAATGTGGACTACCTATCTCGAGATAGGTAGTCCACATTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-343s1c1
Sequence:CCGGGCGCAAGAGACACTGAAATATCTCGAGATATTTCAGTGTCTCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1477s1c1
Sequence:CCGGACTGCCATCCTGTATGGCAATCTCGAGATTGCCATACAGGATGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-1014s1c1
Sequence:CCGGGAAGAGCTTCAAACCGAGATACTCGAGTATCTCGGTTTGAAGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000478.2-393s1c1
Sequence:CCGGCGTGGCTAAGAATGTCATCATCTCGAGATGATGACATTCTTAGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2057s21c1
Sequence:CCGGTTTGGCCAACAGGGTAGATTTCTCGAGAAATCTACCCTGTTGGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-1546s21c1
Sequence:CCGGATGTCTCCATGGTGGACTATGCTCGAGCATAGTCCACCATGGAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000478.3-2110s21c1
Sequence:CCGGCATTCTCAAAGCCTCTTATTTCTCGAGAAATAAGAGGCTTTGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000478.3-961s21c1
Sequence:CCGGAGTATGAGAGTGACGAGAAAGCTCGAGCTTTCTCGTCACTCTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007431
ALPL MISSION shRNA Bacterial Glycerol Stock
alkaline phosphatase, liver/bone/kidney
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007431.1-1860s1c1
Sequence:CCGGGCAGGAACAGAAGTTCGCTATCTCGAGATAGCGAACTTCTGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1067s1c1
Sequence:CCGGGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-928s1c1
Sequence:CCGGGCCTGGATCTCATCAGTATTTCTCGAGAAATACTGATGAGATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1478s1c1
Sequence:CCGGCATGGTAGATTACGCTCACAACTCGAGTTGTGAGCGTAATCTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-317s1c1
Sequence:CCGGGCTCAACACCAATGTAGCCAACTCGAGTTGGCTACATTGGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007431
ALPL MISSION shRNA shRNA Plasmid DNA
alkaline phosphatase, liver/bone/kidney
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007431.1-1860s1c1
Sequence:CCGGGCAGGAACAGAAGTTCGCTATCTCGAGATAGCGAACTTCTGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1067s1c1
Sequence:CCGGGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-928s1c1
Sequence:CCGGGCCTGGATCTCATCAGTATTTCTCGAGAAATACTGATGAGATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1478s1c1
Sequence:CCGGCATGGTAGATTACGCTCACAACTCGAGTTGTGAGCGTAATCTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-317s1c1
Sequence:CCGGGCTCAACACCAATGTAGCCAACTCGAGTTGGCTACATTGGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007431
ALPL MISSION shRNA Lentiviral Transduction Particles
alkaline phosphatase, liver/bone/kidney
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007431.1-1860s1c1
Sequence:CCGGGCAGGAACAGAAGTTCGCTATCTCGAGATAGCGAACTTCTGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1067s1c1
Sequence:CCGGGCAGTATGAATTGAATCGGAACTCGAGTTCCGATTCAATTCATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-928s1c1
Sequence:CCGGGCCTGGATCTCATCAGTATTTCTCGAGAAATACTGATGAGATCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-1478s1c1
Sequence:CCGGCATGGTAGATTACGCTCACAACTCGAGTTGTGAGCGTAATCTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007431.1-317s1c1
Sequence:CCGGGCTCAACACCAATGTAGCCAACTCGAGTTGGCTACATTGGTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks